Indiegram Examples

From Biowiki
Jump to: navigation, search

Indiegram examples

Some examples of three-way reconstructions of ancestral RNA structures.

The tRNA and nanos examples are somewhat obvious, because some of the branch lengths are very short, so that the inferred ancestral structure is almost identical to one of the extant descendants. However, this does at least illustrate the output of the programs.

Alignment & ancestral structure reconstructed by Indie Gram; sequences reconstructed by XRATE. Colorized using Color Stock.

nanos

Drosophila nanos 3'UTR translational control element (colorized)

# STOCKHOLM 1.0
#=GF NH													 (AF252722.1.810-873/1-64:0.0054939322,(U24695.1.2509-2569/1-61:0.1643350493,
#=GF NH														M72421.1.2491-2554/1-64:0.0001000010)ancestral:0.0054937377)root;
#=GF SC_max_pfold										-256.671
U24695.1.2509-2569/1-61								UG--GAAGAAGCUCUGGCAGCUUUUUAAGCGUUUAUAUAAGA-GUUAUAUAUAUGCGCGUUC----CA
#=GR U24695.1.2509-2569/1-61 SS					 <<--(<<(<<<<<.....>>>>>)>>).<(<(.<<<<<<...-....>>>>>>.)>....)>---->>
#=GR U24695.1.2509-2569/1-61 ancrec_CYK_MAP	 ug--gaagaagcucuggcagcuuuuuaagcguuuauauaaga-guuauauauaugcgcguuc----ca
#=GR U24695.1.2509-2569/1-61 ancrec_CYK_MAP_PP ++--++++++++++++++++++++++++++++++++++++++-+++++++++++++++++++----++
M72421.1.2491-2554/1-64								UGGAGCAGAGGCUCUGGCAGCUUUUGCAGCGUUUAUAUAACAUGAAAUAUAUAUAC----GCAUUCCG
#=GR M72421.1.2491-2554/1-64 SS					 (<<<<<<(<(<<<.....>>>)>)>>>.<<<<.<<<<<<........>>>>>>.>>---->>..>>>)
#=GR M72421.1.2491-2554/1-64 ancrec_CYK_MAP	 uggagcagaggcucuggcagcuuuugcagcguuuauauaacaugaaauauauauac----gcauuccg
#=GR M72421.1.2491-2554/1-64 ancrec_CYK_MAP_PP ++++++++++++++++++++++++++++++++++++++++++++++++++++++++----++++++++
AF252722.1.810-873/1-64								NGGAGCAGAGGCUCUGGCAGCUUUUGCAGCGUUUAUAUAACAAGAAAUAUAUAUAC----GCAUUCCG
#=GR AF252722.1.810-873/1-64 SS					 (<<<<<<(<(<<<.....>>>)>)>>>.<<<<.<<<<<<........>>>>>>.>>---->>..>>>)
#=GR AF252722.1.810-873/1-64 ancrec_CYK_MAP	 uggagcagaggcucuggcagcuuuugcagcguuuauauaacaagaaauauauauac----gcauuccg
#=GR AF252722.1.810-873/1-64 ancrec_CYK_MAP_PP ++++++++++++++++++++++++++++++++++++++++++++++++++++++++----++++++++
ancestral												  '''*******************************************************----*******'''
#=GR ancestral SS										<<<<<<<<<<<<<.....>>>>>>>>>.<<<<.<<<<<<........>>>>>>.>>---->>..>>>>
#=GR ancestral ancrec_CYK_MAP						uggagcagaggcucuggcagcuuuugcagcguuuauauaacaugaaauauauauac----gcauuccg
#=GR ancestral ancrec_CYK_MAP_PP					++++++++++++++++++++++++++++++++++++++++++++++++++++++++----++++++++
root														 '''******************************************************************'''
#=GR root ancrec_CYK_MAP							  uggagcagaggcucuggcagcuuuugcagcguuuauauaacaugaaauauauauacgcgugcauuccg
#=GR root ancrec_CYK_MAP_PP						  ++++++++++++++++++++++++++++++++++++++++++5+++++++++++++9899++++++++
#=GC PS_cons											  .G..G.AGA.GCUCUGGCAGCUUUU..AGCGUUUAUAUAA.A.G..AUAUAUAU.C.....C....C.
#=GC SS_cons											  <<__<<<<<<<<<_____>>>>>>>>>_<<<<_<<<<<<________>>>>>>_>>____>>____>>
//

tRNA

Three short transfer RNAs (colorized)

# STOCKHOLM 1.0
#=GF NH														  (AC008670.6-83725_83795/1-71:0.0001000010,(AB042432.1-14140_14072/1-69:1.1786696444,
#=GF NH															 Z82044.1-16031_16103/1-73:1.1786696444)ancestral:0.0001000010)root;
#=GF SC_max_pfold											 -382.118
AB042432.1-14140_14072/1-69								GUUUCUGUAG-UUGAAU--UA-CAA-CGAUGAUUUUUCAUGUCAUUGGU------------------CGCAGUUGAAUGCUGUGUAGAAAUA
#=GR AB042432.1-14140_14072/1-69 SS					 (<<<<<(..<-<<<...--..->>>->.<<<<(.......)>>>>....------------------<(<<<.......>>>)>)>>>>>).
#=GR AB042432.1-14140_14072/1-69 ancrec_CYK_MAP	 guuucuguag-uugaau--ua-caa-cgaugauuuuucaugucauuggu------------------cgcaguugaaugcuguguagaaaua
#=GR AB042432.1-14140_14072/1-69 ancrec_CYK_MAP_PP ++++++++++-++++++--++-+++-+++++++++++++++++++++++------------------+++++++++++++++++++++++++
Z82044.1-16031_16103/1-73								  GCGGUUGUGGCGA-AGUGGUUA-ACGCACCAGAUUGUGGCUCUGGCACUCGUGGGUUCGAUUCCCAU-----------------CAAUCGCC
#=GR Z82044.1-16031_16103/1-73 SS						<<<(<<<..<<<(-........-)>>>.<<<<<.......>>>>>.....(<<<<.......>>>>)----------------->>>)>>>.
#=GR Z82044.1-16031_16103/1-73 ancrec_CYK_MAP		gcgguuguggcga-agugguua-acgcaccagauuguggcucuggcacucguggguucgauucccau-----------------caaucgcc
#=GR Z82044.1-16031_16103/1-73 ancrec_CYK_MAP_PP	+++++++88++++-++++++++-+++++++++++++++++++++++++8++++++++++++++++++-----------------++++++++
AC008670.6-83725_83795/1-71								ACUUUUAAAG-GAUAACAGCC-AUC-CGUUGGUCUUAGGCCCCAAAAAU-UUUGGUGCAACUCCAAA-----------------UAAAAGUA
#=GR AC008670.6-83725_83795/1-71 SS					 <<<<<<<..<-<<<.......->>>->.<<<<(.......)>>>>....-<<<<<.......>>>>>----------------->>>>>>>.
#=GR AC008670.6-83725_83795/1-71 ancrec_CYK_MAP	 acuuuuaaag-gauaacagcc-auc-cguuggucuuaggccccaaaaau-uuuggugcaacuccaaa-----------------uaaaagua
#=GR AC008670.6-83725_83795/1-71 ancrec_CYK_MAP_PP +++++++9++-++++++++++-+++-++++++++++++++++++++++7-+++++++++++++++++-----------------++++++++
ancestral														'''******************************************************************************************'''
#=GR ancestral ancrec_CYK_MAP							 acuuuuaaagcgauaacagccaaucgcguuggucuuaggccccaaaaauguuuggugcaacuccaaacauaguugaauguuguuuaaaagua
#=GR ancestral ancrec_CYK_MAP_PP						 +++++++9++5++++++++++5+++5++++++++++++++++++++++73+++++++++++++++++37+544445544344+9++++++++
root															  '''******************************************************************************************'''
#=GR root ancrec_CYK_MAP									acuuuuaaagcgauaacagccaaucgcguuggucuuaggccccaaaaauguuuggugcaacuccaaacauaguugaauguuguuuaaaagua
#=GR root ancrec_CYK_MAP_PP								+++++++9++5++++++++++5+++5++++++++++++++++++++++73+++++++++++++++++37+544445544344+9++++++++
#=GC PFOLD													  <<<<<<<<<<<<<<........>>>>>.<<<<.........>>>>..<<<<<<<<.......>>>>>>>>............>>>>>>>>>.
#=GC PS_cons													.....U...G....A...........C.......U.............U....................................A......
#=GC SS_cons													<<<<<<<..<.<<..........>>.>.<<<<<.......>>>>>.......................................>>>>>>>.
#=GC ancestral_SS											 <<<<<<<..<-<<<.......->>>->.<<<<<.......>>>>>....-<<<<<.......>>>>>----------------->>>>>>>.
//