|
|
|
Topics in Fall08 web:
|
Changed: now 15:24 GMT
|
Changed by:
|
|
AComparisonOfTheTwoStructures
|
21 Oct 2008 - 10:23 - r1.2
|
TWikiGuest
|
|
-- TWikiGuest 21 Oct 2008 // The two structures are dissimilar. This result is expected because: // 1. The input sequence is the full sequence of one particular Type I hammerhead ribozyme. // 2. The RFAM structure is a consensus structure for the FAMILY of Type I hammerhead ribozymes. Therefore, it does not represent the full structure of the ribozyme, but rather, just the portion that is conserved throughout the RNA family. //
|
|
|
AlexWu
|
18 Nov 2008 - 21:21 - r1.22
|
AlexWu?
|
|
Name: Alex Wu Major: Computer Science Year: Fourth Email: nanhengwu@berkeley.edu // ^ I am an EECS BS/MS student. This is my last undergrad semester. In my spare time I enjoy playing pool and basketball // My Links // Wikipedia:Human Genome Project // Assignments // AlexWuHomeWork1 // AlexWuRNAFolding // AlexWuNussinov // AlexWuSequenceAlignment // AlexWuMiniFinalReport // Useful Sites // Wikipedia // NCBI //
|
|
|
AlexWuHomeWork1
|
18 Sep 2008 - 10:07 - NEW
|
TWikiGuest
|
|
Homework Assignment 1 // Q1: Computational Biology and Synthetic Biology // The following two topics of Computational Biology are closely related to Synthetic Biology: // DNA Sequencing // o Large-scale genome sequencing efforts continue to provide a wealth of information on naturally occurring organisms. This information provides a rich substrate // from which synthetic biologists can construct parts and devices. // o Synthetic biologists use sequencing to ...
|
|
|
AlexWuMiniFinalReport
|
18 Nov 2008 - 23:50 - r1.8
|
AlexWu?
|
|
Mini Final Project Report // Topic: // species binning for metagenomics // Team Member: // Alex (Nanheng) Wu // Introduction: // Metagenomics is an important field as it allows species that are impossible to culture in the lab to be sequenced and studied. Many previously unknown species are also // discovered in the process of metagenomic sequencing.The binning process is one that attempts to group short reads according to the source genome that they come from ...
|
|
|
AlexWuNussinov
|
30 Oct 2008 - 19:34 - r1.21
|
TWikiGuest
|
|
Sequence Alignment Nussinov Algorithm // Part A. Alignment Application // a. An important approach to protein structure prediction is Comparative Protein Structure Modeling. In this approach a sequence who has known structure and similar sequence to the target is used as template. Sequence alignment can help determine the closeness of two sequences. // b. Sequence alignment programs here can be used to do global or local alignments to see how the protein sequence ...
|
|
|
AlexWuRNAFolding
|
22 Oct 2008 - 20:07 - r1.37
|
TWikiGuest
|
|
RNA Engineering Homework Write up // Question 1. // 1. From the paper by Breaker and Penchovsky I first extracted the sequence of the Hammerhead Riboswitch:GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // 2. To reuse the sequence for other programs, save it as sequence.plain // 3. Run RNAfold as follows: RNAfold –p convert rna.ps off.pdf convert dot.ps offDot.pdf // 5. Open sequence.plain and add a line to represent the constraint ...
|
|
|
AmiVerma
|
15 Sep 2008 - 13:06 - r1.2
|
IanHolmes
|
|
// Name: ami verma // Email: ami.iiit@gmail.com // Comment: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.AmiVermaSandbox just for me // Related topics // Main.ChangePassword //
|
|
|
AminoacidTable
|
12 Sep 2008 - 19:49 - NEW
|
TWikiGuest
|
|
// Main.TWikiGuest 13 Sep 2008 // 2nd Base // ^ ^ U C A G // 1st Base U UUU Phe UUC Phe UUA Leu UUG Leu UCU Ser UCC Ser UCA Ser UCG Ser UAU Tyr UAC Tyr UAA Ochre stop UAG Amber stop UGU Cys UGC Cys UGA Opal stop UGG Trp // ^ C CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg // ^ A AUU Ile AUC Ile AUA Ile AUG Met start ACU Thr ACC Thr ACA Thr ACG Thr AAU Asn AAC Asn AAA Lys AAG ...
|
|
|
AnaDanielaGuajardo
|
17 Nov 2008 - 09:59 - r1.34
|
TWikiGuest
|
|
// Contact Info // Ana Daniela Guajardo // adguajardo@berkeley.edu // Interests // 1. Bioenergy // 1. Metabolic Engineering // 1. Ballet // Other // AminoacidTable // AnaDanielaHW1 // HW2 hw2.pl.txt: Perl Basic // HWRnaFold // HWNussinovAlg // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.AnaDanielaGuajardoSandbox just for me // INTERESTING. // FinalProject08NAS // Wikipedia:Nutella // GENBANK http://www.ncbi.nlm ...
|
|
|
AnaDanielaHW1
|
16 Sep 2008 - 18:05 - r1.11
|
TWikiGuest
|
|
-- Main.TWikiGuest 15 Sep 2008 // 1 Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. Go to: AnaDanielaGuajardo // 2 Give two examples of how computational biology is relevant to synthetic biology. // Computational biology can be used while designing a new protein to see how the protein might fold. // For finding protein coding genes, or other functional DNA regions in the sequenced genome ...
|
|
|
AndrewGearhart
|
16 Sep 2008 - 13:42 - r1.8
|
IanHolmes
|
|
Andrew Gearhart // Profile // Email: agearh@gmail.com // Status: Graduate Student // Major: Computer Science // Education: // BS, Computer Science and Mathematics, University of Delaware (2008) // BA, Psychology, University of Delaware (2008) // Research Interests: // Research background in automated transformation of parallel code, and // compiler optimization // Currently trying to decide between compiler research, computational biology (multiple alignment ...
|
|
|
AshokPatowary
|
06 Sep 2008 - 06:51 - NEW
|
TWikiGuest
|
|
// Name: Ashok Patowary // Email: ashokaperis@yahoo.co.in // Interests: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.AshokPatowarySandbox just for me // Related topics // Main.ChangePassword //
|
|
|
BadLinks
|
10 Nov 2008 - 17:07 - r1.13
|
IanHolmes
|
|
BadLinks // Homework practices that are missing programs or have other issues. // Please edit this page to describe any broken links, uninstalled software or other issues that you find with the lab pages. // // URL: http://biowiki.org/view/Teaching/PrimatePhylogeny // Date reported: Mon, Nov 10 2008 // Reported by: Gabriel Lopez // Description: Missing distance matrix software // At this part: // If a site "has not experienced a mutation", is this the same as ...
|
|
|
BioE144Assignments
|
07 Nov 2008 - 15:55 - r1.8
|
TWikiGuest
|
|
-- Main.ManoshiDatta 12 Sep 2008 // Lab and Homework Assignments // Here are my homework assignments from BioE 131. // // // ManoshiDattaHomework1 // ManoshiDattaHomework2 // ManoshiDattaHomework3 // ManoshiDattaHomework4 // ManoshiDattaHomework5 // ManoshiDattaHomework6 //
|
|
|
BrandonGaytan
|
16 Sep 2008 - 13:36 - r1.45
|
BrandonGaytan?
|
|
// Brandon Gaytánbgaytan(at)berkeley(dot)edu I am a new graduate student in the Molecular Toxicology program. My interests lie within the field of environmental toxiology. Currently, I am doing a rotation in a lab that works on the environmental monitoring of toxic agents in water supplies. I will also be rotating in labs that research the uptake of toxic substances from water/soil by plants or microbes. // EDUCATION // Date Degree Location // 2003-2007 B.A ...
|
|
|
BrandonGaytanAssignment1
|
16 Sep 2008 - 13:36 - r1.42
|
BrandonGaytan?
|
|
-- Main.BrandonGaytan 12 Sep 2008 // 1. Ensure homepage has a photo and biography // link to homepage: BrandonGaytan // 2. Two examples demonstrating how computational biology is relevant to synthetic biology // 1. Synthetic biologists attempting to engineer DNA sequences (e.g synthesizing a genome, perhaps Craig Venter style) must sequence their samples to demonstrate the validity of an experiment. Efficient computational tools, such as , can be used to quickly ...
|
|
|
BrianSiu
|
18 Nov 2008 - 13:26 - r1.4
|
TWikiGuest
|
|
Name: Brian Siu // Email: nairb85@gmail.com // Interests: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.BrianSiuSandbox just for me // Related topics // Main.ChangePassword // fafsaconvert.pl.txt: Perl Basics // Project // TeamMetaGenomasaurusRexMiniReport //
|
|
|
BrianZimmer
|
17 Sep 2008 - 14:40 - r1.5
|
BrianZimmer?
|
|
// Name: Brian Zimmer // Email: brianzimmer@berkeley.edu // Interests: Algorithms, software engineering, synthetic biology, swing dancing ) // I am a 4th year in Electrical Engineering and Computer Science. I recently decided that I'd like to apply my knowledge of CS to a different field, and Computational Biology seems like a natural and very interesting fit. On the side I do massive amounts of swing dancing (going to dance on campus and in SF, as well as teaching ...
|
|
|
BrianZimmerHomework1
|
17 Sep 2008 - 13:56 - r1.7
|
BrianZimmer?
|
|
Set ALLOWTOPICVIEW BrianZimmer // Main.BrianZimmer 15 Sep 2008 // Computational Biology and Synthetic Biology // From what I can tell, computational biology encompasses some of the enabling technologies behind synthetic biology. According the Synthetic Biology Wikipedia Page, sequencing and modeling are two of the key enabling technologies, both of which are linked to computational biology. The relevant sections from the wiki page follow: // Sequencing // ...
|
|
|
BrianZimmerSequenceAlignmentLab
|
31 Oct 2008 - 15:35 - r1.6
|
BrianZimmer?
|
|
-- BrianZimmer 31 Oct 2008 // Part 1 Answers // 1. Having a good sequence alignment with a sequence which you have already predicted the structure of can give you a very good start for predicting the structure of the sequence that you have, and you will spend much less time computing than if you tried to do the prediction ab initio. // 1. Having a good alignment could help you move the evolution of your protein in the direction of another protein whose function ...
|
|
|
CharlesHu
|
21 Nov 2008 - 23:35 - r1.18
|
CharlesHu?
|
|
Name: Charles Hu // Email: c.hu@berkeley.edu // Interests: Music, Sports (Tennis, Squash, Wushu, Running), Video Games BioE: tissue engineering, drug delivery, release kinetics... etc. // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.CharlesHuSandbox just for me // Related topics // Main.ChangePassword // Homeworks // Homework 1 // Homework 2 // Homework 3 // Homework 4 // Homework 5 // Homework 6 // Final Project ...
|
|
|
CharlesHuHomework3
|
15 Oct 2008 - 15:51 - r1.3
|
CharlesHu?
|
|
Charles Hu 17496936 chu08@berkeley.edu // Homework 3 // program name: simulator.pl // Worked with: Jason Gomez // Please see attached. //
|
|
|
CharlesHuHomework5
|
31 Oct 2008 - 17:11 - r1.4
|
CharlesHu?
|
|
Charles Hu Homework 5 // (ON THIS HOMEWORK I WORKED WITH JASON GOMEZ) // // // Part 1 // 1.predicting the three-dimensional structure of a protein sequence; // Structure prediction is based on favorable energy conformation by assessing the amino acid interactions. Accurate sequence alignment will allow for accurate amino acid sequence prediction, thus leading to a viable protein form. // 1.introducing random mutations into a protein sequence for the purposes ...
|
|
|
CharlesHuHomework6
|
05 Nov 2008 - 18:44 - r1.11
|
CharlesHu?
|
|
Charles Hu Homework 6 // 17496936, chu08@berkeley.edu // See attachment (alignment2.pl) for perl program. // Please grade me by Scheme 1. Thanks! //
|
|
|
CharlesHuProject
|
19 Nov 2008 - 14:11 - r1.7
|
CharlesHu?
|
|
Bio E? 131 Mini-report // 11/19/2008 // Team members: // Charles Hu, Jason Gomez, Jefferson Chang // Topic #3: // A phylogenomic survey of the phospholipid synthesis pathway // Purpose: // To investigate the presence or absence of proteins involved in inositol biosynthesis in genomes of bacterial, archaeal, and eukaryotic organisms, and to compare the biological relatedness between these organisms. Through this experiement we will be able to get an understanding ...
|
|
|
DavidJiangLiHomework1
|
17 Sep 2008 - 19:54 - r1.8
|
DavidLi?
|
|
-- DavidLi 18 Sep 2008 // Part One // Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. // See DavidLi // Part Two // Give two examples of how computational biology is relevant to synthetic biology. // Problems encountered in synthetic biology obviously involve handling an enormous amount of information. Take, for example, the construction of a genomic library for a given organism of interest ...
|
|
|
DavidJiangLiHomework4
|
20 Oct 2008 - 15:35 - r1.10
|
DavidLi?
|
|
-- DavidLi 20 Oct 2008 // RNA Folding // Part 1: // Off Configuration: // 1. Predicted MFE Structure: // Use RNAfold with parameter p to calculate the MFE structure. The sequence to use is: // GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // The result from RNAfold is: // length 80 // GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // ((((((((.......((((((...........................)))))).. ...
|
|
|
DavidJiangLiHomework5
|
31 Oct 2008 - 09:46 - r1.6
|
DavidLi?
|
|
-- DavidLi 25 Oct 2008 // Part 1 // 1) When attempting to predict the 3-dimensional structure of a protein from its amino acid sequence, a good sequence alignment can allow one to predict structure homology. If a good alignment exists with a sequence whose protein structure has already been discovered, then it is often reasonable to predict the structure of the new protein to be similar. // 2) For in vitro evolution experiments, it is important for the researcher ...
|
|
|
DavidJiangLiProposal
|
19 Nov 2008 - 06:08 - NEW
|
DavidLi?
|
|
// DavidLi 19 Nov 2008 // Final Project // Project: METAGENOMICS // We will examine the ability of probabilistic models to correctly identify the source of small DNA sequences taken from a range of organisms found in an environmental sample. // Group Members // Patrick Harrigan // David Li // Jason Pai // Robert Kuo // Methods // In order to identify the source of the small DNA segments, we will generate nucleotide order statistics from known genomes of species ...
|
|
|
DavidLi
|
19 Nov 2008 - 06:08 - r1.6
|
DavidLi?
|
|
Name: Jiang Li // Email: one.mighty.duck@gmail.com // Bio: I normally just go by David. I'm an undergraduate transfer student in my second year at Berkeley in Bioengineering. I'm interested in computational biology as a tool for the design of new biological systems. My dream for the future of biology is for us to be able to design solutions to problems using human-engineered biological cells and organisms. // Final Project Mini Proposal // DavidJiangLiProposal ...
|
|
|
DavidT
|
19 Nov 2008 - 14:43 - r1.13
|
DavidT?
|
|
About Me // David Tulga is currently a fourth year Bioengineering major at UC Berkeley. He is also a Regents' and Chancellor's Scholar and an undergraduate researcher in the Arkin Laboratory for quantitative biology. During the summer of 2007 he participated on the 2007 Berkeley iGEM Team. During the summer of 2006 through the spring of 2007, he was an undergraduate researcher in Dr. Steven E. Brenner's Computational Genomics Research Group. Additionally, during ...
|
|
|
DavidTHomeworkRNA
|
22 Oct 2008 - 20:46 - r1.10
|
DavidT?
|
|
RNA Folding Homework for David Tulga // Hammerhead ribozyme YES gate Verification // OFF Structure: (MFE 35.90 kcal/mol) // if(navigator.appName.indexOf("Microsoft") ! 1) { document.write(''); } else { document.write('If you cannot see the interactive SVG plot, then click here for a PNG version of the structure.'); } // OFF Base-Pairing Probability Plot: // OFF Accessibility: // Stems I and III are formed, but stem II is not formed, with stem IV formed instead ...
|
|
|
DerekDashti
|
19 Nov 2008 - 14:57 - r1.51
|
MatthewChin?
|
|
// My Profile // Derek Dashti // I am resting on half dome :yes: // dcdashti@berkeley.edu :scull: // I am a 4th year undergraduate majoring in Bioengineering. I have been doing stem cell research under Irina Conboy for over 2 years. Currently, I am trying to computationally model the Notch stem cell pathway. // Interests // I like to play basketball, ski, and run. // Top 5 foods I like to eat // 1. Pizza :-) // 2. Meaty Sandwiches // 3. Pineapple :D // 4. Coconut ...
|
|
|
DerekDashtiHomeWork4
|
22 Oct 2008 - 16:27 - r1.8
|
DerekDashti?
|
|
-- DerekDashti 22 Oct 2008 // Part 1 // To predict the MFE structure I used the RNAfold program for the given RNA sequence in figure 2 of the Breaker paper GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC. After inputting the sequence after calling RNAfold I got a structure like this ((((((((((((((((((((.(..(((.......))).)))))))).))))).....(((((....))))).)))))))) with a minimum free energy of 35.10 kcal/mol. I assumed this is ...
|
|
|
DerekDashtiHomeWork5
|
31 Oct 2008 - 19:34 - r1.2
|
DerekDashti?
|
|
-- DerekDashti 31 Oct 2008 // Part 1 // 1) A good sequencing alignmnet is crucial for predicting a 3 dimensional structure of a protein sequence because structure prediction is based off of algorithm's involving sequence alignments. For example, the nussinov algorithm helps predict a secondary RNA structure due to precise sequence alignment data and without a good sequence alignmnet one could not figure out how bases or amino acids could come together to form ...
|
|
|
EvanYang
|
18 Nov 2008 - 13:16 - r1.27
|
EvanYang
|
|
// // ^ Name: Evan Yang // ^ Email: yang the letter e @ schoolname .edu // ^ Interests: Just about everything... // The Biography thing // I'm a third-year in Bioengineering and Computer Science. It sounds impressive, except I have very little idea about bioinformatics and computational biology // // Homework // Fall08.EvanYangHomework1 // Fall08.EvanYangHomework4 // Fall08.EvanYangHomework5 // Fall08.EvanYangHomework6 // Project // TeamMetaGenomasaurusRexMiniReport ...
|
|
|
EvanYangHomework1
|
17 Sep 2008 - 13:30 - r1.23
|
TWikiGuest
|
|
-- EvanYang 17 Sep 2008 // // Homework 1 // 1 Fall08.EvanYang // 2 Computational Biology is relevant to Synthetic Biology for modeling, and organizing the massive amounts of information obtained from sequencing // 3 The Storm botnet was written with malicious intent, while the Samhain worm was written for more speculative reasons. Other then that, they are relatively similar. Like any organism, it can reproduce, defend itself (!DDoS, killing traces), and select ...
|
|
|
EvanYangHomework4
|
22 Oct 2008 - 22:23 - r1.12
|
TWikiGuest
|
|
-- EvanYang 23 Oct 2008 // Part 1: // To determine the structure of the OFF position and the base-pairing probability plot of the YES gate, we add the p command, which also produces a base-pairing probability plot as an output. // RNAfold p // Text prompting for input : // GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // To determine the structure of the ON position and the base-pairing probability plot of the YES gate, we ...
|
|
|
EvanYangHomework5
|
30 Oct 2008 - 03:46 - r1.5
|
EvanYang
|
|
Part 1: // 1. Having a good sequence alignment can allow one to infer the structure of the protein sequence from the similar sequence. // 2. Odds are, if there a mutated sequence does not have a good alignment with other known sequences, the mutation was selected against, and thus doesn't show up in normal sequences. // 3. Aligning the bacterial gene with the affected host genome can indicated if the introduction was successful // 4. These elements should have ...
|
|
|
EvanYangHomework6
|
07 Nov 2008 - 02:55 - r1.2
|
TWikiGuest
|
|
This is my Needleman Implementation. I did the first 130 lines or so trying to maintain good coding practice, but the last 100 lines are messy. I made conscious decisions along the way to avoid getting above an O(nm) runtime, although I made no other effort to optimize it. As I believe I have completed everything, I'm going to request grading scheme 1. Also, I'm using up my extension on this assignment. // Also, I cannot add/modify attachments anymore. Anybody ...
|
|
|
FelixMoser
|
14 Sep 2008 - 20:20 - r1.11
|
FelixMoser?
|
|
Felix Moser // Email: fmoser@berkeley.edu // Interests: synthetic biology, metabolic engineering, systems biology // Brief Bio: I am a first year PhD student in the UCSF/UCB Joint Graduate Group in Bioengineering. I am interested in synthetic biology, cellular systems design, metabolic engineering, and deterministic cellular programming...which are all pretty much the same thing. I got my BA from Cornell University in biology and chemistry in 2007 and worked ...
|
|
|
FelixMoserHw1
|
15 Sep 2008 - 11:10 - r1.11
|
TWikiGuest
|
|
Set ALLOWWEBVIEW // Main.FelixMoser 15 Sep 2008 // 1. Go back to FelixMoser // 2. Computational biology tackles handling of large amount of biological data relevant to cellular (re)programming (synthetic biology). DNA is the language of biology. If one knows how to code in DNA, one can write a biological "program" into the cell that may lead the cell to producing new compounds or displaying new behaviors. Since the amount of biological data, especially DNA ...
|
|
|
FinalPresentationSchedule
|
31 Jul 2008 - 11:50 - r1.23
|
IanHolmes
|
|
Presentations for the !BioE131 FinalProject will take place during TBA . // Please edit this page to sign up for a time. // If there is more than one person in your group (remember that your presentation should be 5 minutes per person ), please sign up for a block of time, using the name of each person in your group. // Name Time Date //
|
|
|
FinalProject
|
08 Nov 2008 - 09:58 - r1.76
|
IanHolmes
|
|
Final project // This page outlines the final project possibilities for Teaching.BioE131/231. // Brief summmary of rules // The project topics are listed below. // You will write up a report of your project on the wiki page (including a mini-report, three weeks in) // and you'll also give a 5-minute presentation at the final exam. // Breakdown of credit // Credit will be broken down as follows: // 20 for the mini-report (wiki page to be reviewed on November ...
|
|
|
FinalProject08NAS
|
19 Nov 2008 - 15:36 - r1.6
|
NinaRevko
|
|
-- TWikiGuest 17 Nov 2008 // MINIREPORT // Group Members: // Nina Revko, Suruchi Anand, and Ana Daniela Guajardo // Project Topic: // Topic #1 Species Binning for Metagenomics. // INTRODUCTION // The goal of metagenomics is to study genetic material recovered directly from environmental samples. // Metagenomics data processing follows essentially the same steps as processing of shotgun sequences generated for isolate genomes, starting with the assembly of sequence ...
|
|
|
FinalProjectMiniProposal
|
18 Nov 2008 - 20:49 - r1.12
|
TWikiGuest
|
|
Final Project // Project: METAGENOMICS // We will examine the ability of probabilistic models to correctly identify the source of small DNA sequences taken from a range of organisms found in an environmental sample. // Group Members // Patrick Harrigan // David Li // Jason Pai // Robert Kuo // Methods // In order to identify the source of the small DNA segments, we will generate nucleotide order statistics from known genomes of species believed to be present ...
|
|
|
GabrielLopez
|
14 Nov 2008 - 10:03 - r1.18
|
GabrielLopez
|
|
Name: Gabriel Lopez // Email: gabriel.lopez@berkeley.edu // Interests: Synthetic Biology, Tissue Engineering // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.GabrielLopezSandbox just for me // Related topics // Main.ChangePassword // 1. About Me // I am a first year BioE Ph.D. student interested in either synthetic biology or tissue engineering. I am from the LA area, Pasadena specifically, attended UCSB for my undergrad ...
|
|
|
GeneWolfe
|
09 Sep 2008 - 01:22 - NEW
|
TWikiGuest
|
|
// Name: Gene Wolfe // Email: genewolfe@yam.biowiki.org // Interests: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.GeneWolfeSandbox just for me // Related topics // Main.ChangePassword //
|
|
|
GraduateFinal
|
05 Nov 2007 - 18:50 - r1.7
|
IanHolmes
|
|
BioE241 "final" // The following is a proposal for the loosely styled Teaching.BioE241 in-class "final", to be held on the last day of instruction (Monday December 10th). // The general theme is a discussion of probabilistic computational biology algorithms, methods or models applicable to any/all sections of the following paper: // // Particular examples of discussion topics: // how is "adaptation to radiotolerance" hypotheses II ruled out? // how is the RDRM ...
|
|
|
HWNussinovAlg
|
30 Oct 2008 - 20:27 - NEW
|
TWikiGuest
|
|
// TWikiGuest 31 Oct 2008 // Part 1. Written Part // 1. By obtaining a good sequence alignment, crystallography 3D structures obtained from those homologous sequences can be used to predict the structure of the new protein and find molecular and functional relationships between proteins. // 2. Sequence with random mutations could be aligned to the original protein sequences and find how the sequence affect the protein structure as well as its function. // ...
|
|
|
HWRnaFold
|
22 Oct 2008 - 16:55 - r1.22
|
TWikiGuest
|
|
-- TWikiGuest 22 Oct 2008 // Hammerhead ribozyme YES gate. // Copied Hammerhead sequence into a file. // The file HHseqoff.txt containing all the sequence in RNA form in one line was created. // gggcgacccugaugagcuugaguuuagcucgucacuguccagguucaaucaggcgaaacggugaaagccguagguugccc // The file HHseq.txt containing the complete RNA sequence in the first line was created, a line under this first line was filled with spaces and x, filling in an x under the nucleotides ...
|
|
|
JSKSLFinalProject
|
18 Nov 2008 - 17:43 - r1.22
|
SiddharthShah
|
|
The Final Project Siddharth Shah and Jason Lee // Mini-report // Logistics // The partners are (in no particular order): // Jason Lee // Siddharth Shah // We are planning to do project #1, species binning for metagenomics. // We intend to use the DECF computers and our personal computers to program the algorithms. // Binning Algorithm // Our binning algorithm will attempt to incorporate both compositional statistics and the Needleman-Wunsch pairwise alignment ...
|
|
|
JasonGomezBernal
|
19 Nov 2008 - 13:29 - r1.26
|
JasonGomezBernal?
|
|
Jason Gomez Bernal // // Table of Contents // // My Info // Name: Jason Gomez Bernal // ^ Email: b g@pacbell.net // ^ Autobiography: I am a fourth year undergraduate bioengineering student interested in pursuing prosthetic devices and practicing as an orthopedic surgeon. Currently I enjoy playing a lot of sports including football, tennis, golf, basketball, and capoeira. I grew up in Oakland and Berkeley before moving to Clayton with my parents where I would ...
|
|
|
JasonGomezBernalHomework1
|
16 Sep 2008 - 21:46 - r1.11
|
JasonGomezBernal?
|
|
Jason Gomez Bernal Homework 1 // // // Question 1 // 1. See JasonGomezBernal // Question 2 // 1. Designer Drugs // Identification of different loci/targeting centers necessary for a drug to be effective. // Collaborative knowledge to assist development by bypassing the need for redundant research through shared knowledge bases. // Protein recognition and functional understanding. // 1. Designer Organisms // Widespread availability of genomes through databases ...
|
|
|
JasonGomezBernalHomework4
|
22 Oct 2008 - 12:40 - r1.26
|
JasonGomezBernal?
|
|
Jason Gomez Bernal Homework 4 // // // Hammerhead Ribozoyme YES Gate // Off-state // Within a terminal: // // RNAfold p // Input string (upper or lower case); @ to quit // ....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8 // GGGCGACCCUGAUGAGCUUGAGUUUagcucgucacuguccagguucaAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // ((((((((((((((((((((.(..(((.......))).)))))))).))))).....(((((....))))).)))))))) // minimum free energy 35.10 kcal/mol // ...
|
|
|
JasonGomezBernalHomework5
|
31 Oct 2008 - 19:48 - r1.8
|
JasonGomezBernal?
|
|
Jason Gomez Bernal Homework 5 // (ON THIS HOMEWORK I WORKED WITH CHARLES HU) // // // Part 1 // 1.predicting the three-dimensional structure of a protein sequence; // Structure prediction is based on favorable energy conformation by assessing the amino acid interactions. Accurate sequence alignment will allow for accurate amino acid sequence prediction, thus leading to a viable protein form. // 1.introducing random mutations into a protein sequence for the purposes ...
|
|
|
JasonGomezBernalMiniReport
|
19 Nov 2008 - 13:28 - r1.2
|
JasonGomezBernal?
|
|
Jason Gomez Bernal Mini Report // // // Team members: // Charles Hu, Jason Gomez, Jefferson Chang // Topic #3: // A phylogenomic survey of the phospholipid synthesis pathway // Purpose: // To investigate the presence or absence of proteins involved in inositol biosynthesis in genomes of bacterial, archaeal, and eukaryotic organisms, and to compare the biological relatedness between these organisms. Through this experiement we will be able to get an understanding ...
|
|
|
JasonLee
|
01 Nov 2008 - 20:53 - r1.14
|
JasonLee?
|
|
Profile // Name: Jason Lee // Major: Bioengineering // Year: Sophomore // Email: jasonslee@berkeley.edu // About Me: I am currently trying to find a track that I like in my major. Currently I am considering computational Bioengineering and Biomedical Materials. // Some Links // xkcd comics // Wikipedia // Assignments // JasonLeeHomeWork1 // JasonLeeHomework4 // JasonLeeHomework5 // Related topics // Main.ChangePassword //
|
|
|
JasonLeeHomeWork1
|
18 Sep 2008 - 08:12 - r1.27
|
IanHolmes
|
|
Homework Assignment 1 // Q1: Computational Biology and Synthetic Biology // The following two topics of Computational Biology are closely related to Synthetic Biology: // Genomes // Problems encountered in synthetic biology, such as the structures of proteins, require a wealth of information on naturally occurring organism. Finding whole genomic libraries of specified organisms takes an enormous amount of processing. // Synthetic biologists use sequencing in ...
|
|
|
JasonLeeHomework4
|
22 Oct 2008 - 17:57 - r1.13
|
JasonLee?
|
|
-- JasonLee 22 Oct 2008 // RNA Folding // Part I: // Hammerhead ribozyme YES gate // Off configuration // 1. Predicted MFE Structure using RNAfold // Sequence: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // be131-14@kepler ~ 10:38pm RNAfold p // Input string (upper or lower case); @ to quit // ....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8 // GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...
|
|
|
JasonLeeHomework5
|
01 Nov 2008 - 22:51 - r1.5
|
JasonLee?
|
|
-- JasonLee 31 Oct 2008 // Homework Assignment 5 // Part I // 1. Having a good sequence alignment can assist predicting the three-dimensional structure of a protein sequence by finding similar proteins whose structures have already been identified. Then the unknown sequence can be predicted by comparing it to a known sequence. // 2. When introducing random mutations, you don't know what part of the sequence changes unless you have a good sequence alignment. ...
|
|
|
JasonPai
|
18 Nov 2008 - 20:52 - r1.42
|
JasonPai?
|
|
TABLE OF CONTENTS // /Me.jpg // Name: Jason Pai // Email: jason314@berkeley.edu // Interests: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.JasonPaiSandbox just for me // Related topics // Main.ChangePassword // Autobiography // My name is Jason Pai, and I am currently a junior at the University of California at Berkeley, but have permanent residence in Washington State. My primary interest in bioengineering is ...
|
|
|
JasonPaiHomework1
|
16 Sep 2008 - 23:15 - r1.26
|
JasonPai?
|
|
Homework 1 // Question 1: Biowiki Homepage // See biowiki.org homepage for picture and short autobiography. // Question 2: Computational Biology and Synthetic Biology // One way in which computation biology is relevant to synthetic biology is the use of computational biology in the identification of genomic "parts"; that is, computational algorithms can be written to analyze sequences of DNA to try to find patterns in them which may relate to certain functionalities ...
|
|
|
JasonPaiHomework2
|
20 Oct 2008 - 16:51 - r1.35
|
JasonPai?
|
|
Homework Lab 6 // Homework // This homework comes in three parts. // Hammerhead ribozyme YES gate // Verify the properties of the YES-1 gate in Figure 2 of the RNA logic gates paper by Breaker and Penchovsky, covered in class: // Penchovsky R, Breaker RR. Computational design and experimental validation of oligonucleotide-sensing allosteric ribozymes. Nat Biotechnol. 2005 Nov;23(11):1424-33. Epub 2005 Oct 23. // NB: the relevant RNA sequence is given in Figure ...
|
|
|
JasonPaiHomeworkLab6
|
21 Oct 2008 - 20:56 - r1.20
|
JasonPai?
|
|
Homework Lab 6 // Hammerhead ribozyme YES gate // YES Gate OFF Position: // To find the predicted MFE structure and generate the base-pairing probability plot, I ran RNAfold in the terminal with the p option, with the command "RNAfold p". I then typed " OFFdata" and pressed enter, then typed the hammerhead ribozyme sequence GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC and pressed enter, and the relevant output was: // length ...
|
|
|
JeffersonChang
|
17 Sep 2008 - 14:17 - r1.5
|
JeffersonChang
|
|
Name: Jefferson Chang // Email: jefferson.chang825@gmail.com // Interests: Computational Biology, Pharmaceuticals, !DotA // Year: 4th Undergrad // Photo: TBA // JeffersonChangHomework1 // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.JeffersonChangSandbox just for me // Related topics // Main.ChangePassword //
|
|
|
JeffersonChangHomework1
|
17 Sep 2008 - 17:01 - r1.9
|
JeffersonChang
|
|
-- JeffersonChang 17 Sep 2008 // Computational biology allows us to compute and study the dynamics of a biological system before experimentally synthesizing it. Additionally, bioinformatics and databases give us the information we need to make these calculations. // Transposons are sequences of DNA that can move around the genome. On the other hand, viruses are infectious agents that can insert their genomes into their hosts and force their hosts to replicate ...
|
|
|
JgiTour
|
15 Nov 2008 - 20:53 - r1.49
|
WeiChunHsu
|
|
Tour of the Joint Genome Institute // On Friday November 14th, in place of the regular BioE131 lecture, there will be an afternoon tour of the Joint Genome Institute, the !DoE sequencing center in Walnut Creek. // Jim: // For those wondering what I was doing running around with a SLR camera, here are some pics I took. // Update #2: // I've just heard from JGI that they will be unable to provide a bus on Friday (as they have in previous years). This means that ...
|
|
|
JoannaChen
|
22 Nov 2008 - 00:17 - r1.19
|
JoannaChen?
|
|
// // About Me // Name: Joanna Chen // Email: chen j (at) berkeley (dot) edu // 3rd year Bioengineering undergraduate // Interests in bioengineering: computational bioengineering still exploring the various sub-areas (so far, protein structure prediction seems interesting) // Student societies involved in: Tau Beta Pi Engineering Honor Society (TBP), Engineering World Health (EWH) // Hobbies: playing the piano, beading // // My Assignments // Homework 1 // ...
|
|
|
ManoshiDatta
|
11 Nov 2008 - 10:35 - r1.48
|
ManoshiDatta?
|
|
MANOSHI DATTA // // Affiliations: Department of Bioengineering (third-year undergraduate) // Hometown: West Lafayette, IN // Email: mdatta@berkeley.edu // Interests: Systems biology, peptide-based therapeutics, tennis, reading, international affairs, and outdoor adventures // Hi! My name is Manoshi, and I am a student in !BioE 131. I developed an interest in bioinformatics tools after learning about their utility in the field of systems biology. I hope to be ...
|
|
|
ManoshiDattaHomework4
|
22 Oct 2008 - 15:01 - r1.38
|
TWikiGuest
|
|
-- TWikiGuest 21 Oct 2008 // Part I: Hammerhead Ribozyme YES Gate // METHODS // First, I copied the nucleotide sequence of the hammerhead ribozyme to a text file. This file, called "hammerhead.seq," is attached to this page. It looks something like this: // Name of file: hammerhead.seq // sequence 1 // GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC // Then, I issued the following command from the command line: // RNAfold p hammerhead ...
|
|
|
ManoshiDattaHomework5
|
22 Oct 2008 - 09:51 - r1.7
|
TWikiGuest
|
|
-- TWikiGuest 22 Oct 2008 // Part 1: Written Part // 1. Predicting the three-dimensional structure of a protein sequence. // In order to predict the three-dimensional structure of an unknown protein query, a BLAST search can find proteins with a high level of sequence identity to the query sequence. If these proteins also have a known structure, it can be inferred that the query protein will have a similar structure. However, a global-global alignment must be ...
|
|
|
MattCairns
|
15 Sep 2008 - 15:04 - NEW
|
TWikiGuest
|
|
// Name: Matt Cairns // Email: mattcairns@yam.biowiki.org // Interests: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.MattCairnsSandbox just for me // Related topics // Main.ChangePassword //
|
|
|
MatthewChin
|
19 Nov 2008 - 14:55 - r1.37
|
MatthewChin?
|
|
Name: Matthew Chin // Email: mchin88@berkeley.edu // Interests: // My Links // .WelcomeGuest to learn TWiki // Sandbox.WebHome web to try out TWiki // Sandbox.MatthewChinSandbox just for me // NOTE: Assignment 1 is in the Matthew Chin Sandbox page (link is right above). // MiniReport For Final // MiniReportDDashtiMChin // Needleman-Wunsch Algorithm // NeedlemanWunschAssignment // Sequence Alignment // SequenceAlignmentAssignment // RNA folding // PART 1: // ...
|
|
|
