|
| Homework Lab 6
Hammerhead ribozyme YES gate
YES Gate OFF Position:
To find the predicted MFE structure and generate the base-pairing probability plot, I ran RNAfold in the terminal with the -p option, with the command "RNAfold -p". I then typed ">OFFdata" and pressed enter, then typed the hammerhead ribozyme sequence GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC and pressed enter, and the relevant output was:
length = 80
GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
((((((((((((((((((((.(..(((.......))).)))))))).))))).....(((((....))))).))))))))
minimum free energy = -35.10 kcal/mol
(((((((((((((((((({(.,..,||,,,,...}}}.|})))))),,)))).....(((((....))))).))))))))
free energy of ensemble = -37.93 kcal/mol
((((((((((((.(((((((...................)))))))..)))).....(((((....))))).)))))))) {-29.41 d=10.92}
frequency of mfe structure in ensemble 0.0836646; ensemble diversity 15.95
... and the files OFFdata_ss.ps and OFFdata_dp.ps were generated. To access these files, I first converted them to .pdf files, using the commands, "convert OFFdata_ss.ps OFFdata_ss.pdf" and "convert OFFdata_dp.ps OFFdata_dp.pdf". Here is the base-pairing probability plot and MFE Structure for the YES Gate OFF position:
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/OFFdata_dp.pdf
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/OFFdata_ss.pdf
Status: Stems I and III are formed, but stem II is disrupted by the formation of stem IV. The cleavage site is not accessible in this OFF position.
YES Gate ON Position:
To find the predicted MFE structure and generate the base-pairing probability plot, I ran RNAfold in the terminal with the -p and -C option, with the command "RNAfold -p -C". From there, I inputted...:
> ONdata
GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC (pressed enter after entering this)
xxxxxxxxxxxxxxxxxxxxxx (lined up the x's (indicating no base-pairing to other parts of the hammerhead structure) to correspond with the OBS)
... and the relevant output was:
length = 80
GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
((((((((.......((((((...........................))))))...(((((....))))).))))))))
minimum free energy = -28.53 kcal/mol
((((((((.......((((((...........................))))))...(((((....))))).))))))))
free energy of ensemble = -29.02 kcal/mol
((((((((.......((((((...........................))))))...(((((....))))).)))))))) {-28.53 d=0.89}
frequency of mfe structure in ensemble 0.621842; ensemble diversity 1.67
... and the files ONdata_ss.ps and ONdata_dp.ps were generated. I converted them to .pdf files as above. Here is the base-pairing probability plot and MFE Structure for the YES Gate ON position:
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/ONdata_dp.pdf
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/ONdata_ss.pdf
Status: Stems I, II, and III are all formed, since the former stem IV is now forming base pairs with DNA-1. The cleavage site is accessible in this ON position.
Software for verifying YES gate
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/Verify.doc
Hammerhead ribozyme structure
I went to the NCBI Genbank website, changed the display type to FASTA sequence, and then used "send to -> file" to output nucleotides 70-186 to a fasta file. I ran "RNAfold -p", then typed the name ">NCBIHammerhead", then the sequence CTTTCCCTGAAGAGACGAAGTGATCAAGAGATCGAAGACGAGTGAACTAATTTTTTTTAATAAAAAGTTCACCACGACTCCTCCTTCTCTCACAAGTCGAAACTCAGAGTCGGCAAG. The output was:
length = 117
CUUUCCCUGAAGAGACGAAGUGAUCAAGAGAUCGAAGACGAGUGAACUAAUUUUUUUUAAUAAAAAGUUCACCACGACUCCUCCUUCUCUCACAAGUCGAAACUCAGAGUCGGCAAG
...........((((.((((.((((....)))).....((.(((((((...((((......)))))))))))..)).......))))))))....(((((.........)))))...
minimum free energy = -24.60 kcal/mol
...........((((.((((,((((....))))|..{.((.(((((((..,{((,......)))})))))))..)).,},.,,))))))))....(((({..,......)))))...
free energy of ensemble = -28.15 kcal/mol
...........((((.((((.((((....)))).....((.(((((((.................)))))))..)).......))))))))....(((((.........)))))... {-24.13 d=14.09}
frequency of mfe structure in ensemble 0.00314648; ensemble diversity 23.79
I then converted the NCBIHammerhead_ss.ps and NCBIHammerhead_dp.ps files to .pdf files as above. Here is the predicted MFE structure (and base-pairing probability plot) based on the NCBI sequence:
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/NCBIHammerhe_ss.pdf (Note that the name I entered was truncated to "NCBIHammerhe" by RNAfold)
http://biowiki.org/twiki/pub/Fall08/JasonPaiHomeworkLab6/NCBIHammerhe_dp.pdf
Here is the Rfam Hammerhead structure (type 1):
Hammerhead ribozyme (type I)
It is clear that the two structures look different. This may be explained by the fact that the structures we are comparing have very different lengths: the NCBI Hammerhead sequence we used has a length of 117 basepairs, and the Rfam Hammerhead sequence has a length of ~45 base pairs.
-- Jason Pai - 20 Oct 2008 |
