Home - this site is powered by TWiki(R)
Fall11 > WebChanges
TWiki webs: Main | TWiki | Sandbox   Log In or Register

Changes | Index | Search | Go
Topics in Fall11 web
Changed
Changed by

Statistics for nop Fall11 Web Month: Topic views: Topic saves: File uploads: Most popular topic views: Top contributors for topic save ...
Name: QatriNNmu Email: laekmooedj #64;csmkmooepj.com My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki QatriNNmuSandbox just ...
.JacobVogan 04 Dec 2011 Homework #9 Phylogeny analysis using UPGMA (Unweighted Pair Group Method with Arithmetic Mean) tree.pl.txt: A perl script that outputs ...
Nathan Woo nwoonet #64;berkeley.edu nwoonet #64;gmail.com Nathan Woo is a third year undergraduate student in UC Berkeley's Department of Bioengineering ...
.TWikiGuest 03 Dec 2011 Code: hw7.pl The newick format tree generated using ATP6.distmat by the program is attached below (newick.txt). The tree from my program ...
Name : Tahoura Samad Email : tahourasamad #64;gmail.com Interests : synthetic biology About Me Hi! My name is Tahoura , and I'm a third year bioengineering student ...
.DanielChao 04 Dec 2011 Worked with SwethaAkella Link: SwethaAkellaHW9
Basic Information Name: Douglas Treadwell Email: douglas.treadwell #64;berkeley.edu Interests: computational biology, artificial intelligence, web ...
About Me Name : Max Bates Email : maxbates #64;gmail.com Interests : GMOs, herbal medicine, personal medicine I'm a fourth year Bioengineering ...
Name: JaniNNeTelameEs Email: yywkmooezvljikmooesi #64;zlvkmooespyslkmooevc.com Interests: Cycling My Links .WelcomeGuest to learn TWiki WebHome ...
.MatthewTran 30 Nov 2011
.HyungjunKim 30 Nov 2011 HW is attached
.JacobVogan 24 Nov 2011 Homework #8a Bayesian Analysis of DNA sequence Origin ORFprob.pl: ORF Bayesian Perl script outputs posterior probability on sequence ...
.MaxBates 29 Nov 2011 NOTE I worked with Marcus Macaulay on this homework assignment Open Reading Frames The script is attached: hw6a.pl.txt See program ...
.DanielChao 28 Nov 2011 Worked with SwethaAkella Link: SwethaAkellaHW8
.NathanWoo 20 Nov 2011
.JacobVogan 18 Nov 2011 Perl Nussinov Table Script nu table.pl: perl Nussinov RNA folding script that outputs nicely formatted table nu table.pl Features: ...
.JacobVogan 21 Nov 2011 Homework #7 RNA Information Content Script RNAinfo.pl: Perl scripts outputs information content of RNA multiple alignment file (stolkholm ...
.ConorMcclune 22 Nov 2011 Homework 7 1. What does the high mutual information imply about the nucleotides in two columns? The high mutual information implies ...
.MatthewTran 22 Nov 2011
This assignment was completed Homayun Mehrabani who contributed ideas, code, and time to the final product. Homework 7 Information Content Please refer to Homayun ...
.MaxBates 21 Nov 2011 Program See attached: information content.pl.txt Results Output is attached as a separate file: results.txt Discussion is also attached ...
.MaxBates 15 Nov 2011 Final Results ONE: The time is always right to do the right thing TWO: An ounce of practice is worth more than tons of preaching. THREE: ...
.NickElsbree Homework Assignment 6 I would like grading option 1, please. I forgot to mention I worked with Nathan Woo on this one as well.
.JacobVogan 12 Nov 2011 Homework #6 Pairwise Alignment ( Scheme 1 ) pairwise.pl: pair wise alignment based on a matrix file and a FASTA sequence file Pairwise ...
.NickElsbree Homework Assignment 5 Nussinov Algorithm Performance Sequence Length (nucleotides) Runtime (seconds) 8 0.013 16 0.014 32 0 ...
.HyungjunKim 30 Oct 2011 Nussinov Algorithm homework (problem) Implement the Nussinov algorithm Algorithm attached below. Analyze the performance of the Nussinov ...
.TaiNg 16 Oct 2011 .TaiNg 16 Oct 2011 RNA folding Lab Homwork 1. In order to predict the MFE sturcture of the OFF and ON position of the YES 1 seqeunce, we will ...
Hammerhead Ribozyme YES Gate Effector ON Questions 1 2 I have used RNAfold here to generate the structure and probability plot. Note: all commands entered in ...
.TedKim 15 Oct 2011 RNA logic homework PART 1: YES gate OFF state This is the yesgate in the off position. I typed in "RNAfold p" in the command line to get ...
.DouglasTreadwell 16 Oct 2011 1. Analyzing the YES gate Rather than describe the steps in English, I've simply made a program that repeats the necessary steps to predict ...
.AliceYChang 15 Oct 2011 The RNA sequence for the ribozyme is: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC Hammerhead Ribozyme ...
Name: chandni gupta Email: chandnigupta1711 #64;yahoo.in Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki ...
Homework 3 Perl sequence simulator: simulator.pl Homework 3 is a sequence "simulator" that generates random FASTA sequence files with similar statistics to a real ...
.ConorMcclune 09 Oct 2011 Homework #3! The parameter file format includes the sequence length on the first line, and the nucleotides and their counts on subsequent ...
.SwethaAkella 25 Sep 2011 Worked with HomayunMehrabani
.MelvinDu 09 Oct 2011 Homework 3 simulator.pl simulator.pl.txt: main homework file myparam.csv: sample parameter file for loading/saving simulatedSequence ...
.JoyYeh 25 Sep 2011 Homework 2 See attached
Homework 2: This application developed as an assignment for Bioengineering 231 is designed to produce the reverse complement of a sequence inputed as a FASTA file ...
Please visit SuhaniVora
.JacobVogan 08 Sep 2011 Bioengineering 131/231 Homework #1 Part 1: On homepage Part 2: Ricin Ricin is a naturally occurring ribosome inhibiting ...
Set GROUP JanWu GavinSaldanha TedKim NickElsbree AliceYChang AnnieJoseph ConorMcClune DanielChao DavidSpiciarich DavidZeng DouglasTreadwell GaurangGarg GregFukushima ...
.TedKim 09 Sep 2011 One TedKim Two The castor oil plant produces a highly toxic compound ricin. It messes with protein synthesis by screwing with the ribosomes ...
.NickElsbree Homework Assignment 1 Questions 1. See Home Page 1. Wikipedia:Ricin is a toxin which occurs in castor beans, whose sequence was determined ...
Task 1 Please see Suhani Vora Homepage Task 2 Here is a link to a short paragraph about the toxic protein ricin: RicinBackground Task 3 Review paper which summarizes ...
Part A SEE MAIN PAGE Part B (Wikipedia:Ricin) is a natural protein derived from the plant Ricinus communis that is notorious for its toxicity. The median lethal ...
.HugoDermawan 07 Sep 2011 1. See main page. 2. Ricin (Wikipedia:Ricin) is a highly toxic protein found in castor oil plants (Ricinus communis). It is the waste product ...
.AnnieJoseph 09 Sep 2011 Ricin is a very toxic protein that occurs naturally in the castor oil plant. The castor oil plant's genome, also known as communis was published ...


Number of topics: 50

Edit | Attach | Print version | History: r1 | Backlinks | Raw View | Raw edit | More topic actions


Parents: WebHome
This site is powered by the TWiki collaboration platformCopyright © 2008-2013 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback
TWiki Appliance - Powered by TurnKey Linux