SwethaAkellaHW4 < Fall11

Fall11 > TWikiUsers > SwethaAkella > SwethaAkellaHW4

TWiki webs: Main | TWiki | Sandbox Log In or Register

-- %TEACHINGWEB%.SwethaAkella - 15 Oct 2011

Hammerhead Ribozyme YES-1 gate

Predicted MFE structure:

--OFF:

Call RNAfold and enter:

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

convert rna.ps RNAoff.pdf

RNAoff.png:

--ON:

Call RNAfold and enter:

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

GGGCGACCCUGAUGAGCUUGAGUUUxxxxxxxxxxxxxxxxxxxxxxAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

convert rna.ps RNAon3.pdf

RNAon3.png:

Base Pairing Probability Plot

--OFF:

RNAfold -p

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

convert dot.ps plotOFF.pdf

plotOFF.png:

RNAfold -C -p

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

GGGCGACCCUGAUGAGCUUGAGUUUxxxxxxxxxxxxxxxxxxxxxxAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

convert dot.ps plotON.pdf

plotON.png:

Stems and Cleavage Site

Stem 1 - Stem one doesn't change for the on and off conformations.

Stem 2 - In the off state, stem 2 has a long stem with a symmetric bulge and a loop, with most of the nucleotides still paired, blocking the cleavage site. When turned on however, the stem shortens and the large loop with unpaired nucleotides exposes the cleavage site.

Stem 3 - This stem doesn't change, so it doesn't affect the cleavage site.

Software for verifying YES Gate

1. The user must input the RNA sequence and the coordinates of the OBS site.

variables: RNAseq = RNA sequence

catSite = coordinates of OBS.

2. Call RNA plot, enter RNA sequence, and find MFE in the off state.

RNAfold (RNAseq) will return the paired bases

numPairedBases = 0

for all bases within the catSite range

if bases are paired, increment numPairedBases

3. Use the RNAplot output to check how much of the catalytic core is base-paired in the off state at 37 degrees. If it is not between 30 and 70%, the gate is incorrect.

if (numPairedBases/length (RNAseq)) is <.30 || >.70

truth table is 0 1

1 1

4. Call RNA plot and find the structure in the ON state. Use the '-C' option to make sure the OBS is exposed.

RNAfold(RNAseq) again returns paired bases for the on state now

numPairedBases = 0

for all bases within the catSite range

if bases are paired, increment numPairedBases

if (numPairedBases/length (RNAseq)) is >.30 && <.70

truth table is 0 0

1 0

5. Make sure all stems are still present in the ON state. 6. Ensure the change in energy between the two states is 6-10 kJ/mol. 7. Check stability in the desired range (20-40 degrees C) of both the on and off states.

for ($i=20; $i<=40; $i++)

do an RNAplot of temperature = $i

8. If all these conditions are met, print the truth table:

0 0

1 1

Hammerhead Ribozyme

hammerhead.png:

hammerhead_rfam.png:

The structures shown above are different. The algorithms used to calculate the structures in the two programs may vary, and one may take into account more possible interactions than the other. The temperatures at which each structure was calculated may also be influencing the structure. RFAM is also a 3D prediction tool whereas RNAfold is a 2D prediction tool, causing more differences.

I	Attachment	Action	Size	Date	Who
png	RNAoff.png	manage	82.8 K	2011-10-15 - 23:14	SwethaAkella
png	RNAon3.png	manage	19.9 K	2011-10-15 - 23:48	SwethaAkella
png	hammerhead.png	manage	15.3 K	2011-10-16 - 00:30	SwethaAkella
png	hammerhead_rfam.png	manage	11.1 K	2011-10-16 - 00:31	SwethaAkella
png	plotOFF.png	manage	95.6 K	2011-10-15 - 23:57	SwethaAkella
png	plotON.png	manage	85.1 K	2011-10-15 - 23:59	SwethaAkella

Parents: TWikiUsers > SwethaAkella