GavinSaldanhaHW4 < Fall11

Fall11 > BioE131 > GavinSaldanha > GavinSaldanhaHW4

TWiki webs: Main | TWiki | Sandbox Log In or Register

-- %TEACHINGWEB%.GavinSaldanha - 24 Oct 2011

Analyzing the YES-1 gate

This output was generated using the VIENNA pacakge's RNAfold software. This is the structure given if the RNA binds in a Minimum Free Energy (MFE) configuration.

For the OFF position:
input: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
output: ((((((((((((((((((((....(((.......)))..))))))).))))).....(((((....))))).))))))))
MFE: -37.92 kcal/mol

For the ON position:
input: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
constraint: .........................xxxxxxxxxxxxxxxxxxxxxx.................................
output: ((((((((.......((((((...........................))))))...(((((....))))).))))))))
MFE: -28.73 kcal/mol

Structure when On:

Pairing probability plot when On:

Structure when Off:

Pairing probability plot when Off:

Verifying the YES-1 Gate

I really don't know how to do this one. Here is my best guess:

First, the program must read in all necessary inputs. Read in the sequence ($ARGV[0]) and store it, read in the two bounds ($ARGV[1] and $ARGV[2]) and store them.
Go through the sequence between the two bounds and generate DNA-1, the complimentary DNA to that subsequence.
Now run RNAfold on the original sequence. It should match the above diagram of the YES-1 in the off position.
Then run RNAfold on the sequence, giving a constraint that has dots (.) everywhere except between the bounds (which are x's).
This should generate the YES-1 in the on position. If both of these RNAfold outputs match the above graphs, output true for both.
If not output false for whichever plots do not match.

Rfam

Generated rfam using RNAfold:

Actual published structure:

These two structures are considerably different. This just shows that although RNAfold can mimic the bonding probabilities to predict protein structures, such analysis is not always correct. There are some proteins, such as this Rfam, that will not conform in the way expected based on its sequence. Other factors may contribute to its actual structure, which is probably much closer to the published one than the predicted structure.

I	Attachment	Action	Size	Date	Who	Comment
pdf	yes-1_on_plot.pdf	manage	4.1 K	2011-10-24 - 03:42	GavinSaldanha
pdf	yes-1_on_structure.pdf	manage	4.1 K	2011-10-24 - 03:42	GavinSaldanha
pdf	yes-1_off_structure.pdf	manage	4.2 K	2011-10-24 - 03:41	GavinSaldanha
pdf	yes-1_off_plot.pdf	manage	7.1 K	2011-10-24 - 03:41	GavinSaldanha
jpg	rfam.jpg	manage	11.1 K	2011-12-08 - 06:04	GavinSaldanha	Actual published structure
jpg	rfam-gen.jpg	manage	54.8 K	2011-12-08 - 06:04	GavinSaldanha	Generated rfam using RNAfold
jpg	onstruct.jpg	manage	68.1 K	2011-12-08 - 05:58	GavinSaldanha	Structure when On
jpg	offstruct.jpg	manage	75.5 K	2011-12-08 - 05:59	GavinSaldanha	Structure when Off
jpg	onplot.jpg	manage	99.5 K	2011-12-08 - 05:57	GavinSaldanha	Pairing probability plot when On
jpg	offplot.jpg	manage	107.4 K	2011-12-08 - 05:59	GavinSaldanha	Pairing probability plot when Off

Parents: BioE131 > GavinSaldanha