Home - this site is powered by TWiki(R)
Fall11 > BioE131 > GavinSaldanha > GavinSaldanhaHW4
TWiki webs: Main | TWiki | Sandbox   Log In or Register

Changes | Index | Search | Go
-- %TEACHINGWEB%.GavinSaldanha - 24 Oct 2011

Analyzing the YES-1 gate

This output was generated using the VIENNA pacakge's RNAfold software. This is the structure given if the RNA binds in a Minimum Free Energy (MFE) configuration.

For the OFF position:
input: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
output: ((((((((((((((((((((....(((.......)))..))))))).))))).....(((((....))))).))))))))
MFE: -37.92 kcal/mol

For the ON position:
input: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
constraint: .........................xxxxxxxxxxxxxxxxxxxxxx.................................
output: ((((((((.......((((((...........................))))))...(((((....))))).))))))))
MFE: -28.73 kcal/mol

  • Structure when On:
    Structure when On

  • Pairing probability plot when On:
    Pairing probability plot when On

  • Structure when Off:
    Structure when Off

  • Pairing probability plot when Off:
    Pairing probability plot when Off

Verifying the YES-1 Gate

I really don't know how to do this one. Here is my best guess:

First, the program must read in all necessary inputs. Read in the sequence ($ARGV[0]) and store it, read in the two bounds ($ARGV[1] and $ARGV[2]) and store them.
Go through the sequence between the two bounds and generate DNA-1, the complimentary DNA to that subsequence.
Now run RNAfold on the original sequence. It should match the above diagram of the YES-1 in the off position.
Then run RNAfold on the sequence, giving a constraint that has dots (.) everywhere except between the bounds (which are x's).
This should generate the YES-1 in the on position. If both of these RNAfold outputs match the above graphs, output true for both.
If not output false for whichever plots do not match.

Rfam

  • Generated rfam using RNAfold:
    Generated rfam using RNAfold

  • Actual published structure:
    Actual published structure

These two structures are considerably different. This just shows that although RNAfold can mimic the bonding probabilities to predict protein structures, such analysis is not always correct. There are some proteins, such as this Rfam, that will not conform in the way expected based on its sequence. Other factors may contribute to its actual structure, which is probably much closer to the published one than the predicted structure.

I Attachment Action SizeSorted ascending Date Who Comment
Pdfpdf yes-1_on_plot.pdf manage 4.1 K 2011-10-24 - 03:42 GavinSaldanha  
Pdfpdf yes-1_on_structure.pdf manage 4.1 K 2011-10-24 - 03:42 GavinSaldanha  
Pdfpdf yes-1_off_structure.pdf manage 4.2 K 2011-10-24 - 03:41 GavinSaldanha  
Pdfpdf yes-1_off_plot.pdf manage 7.1 K 2011-10-24 - 03:41 GavinSaldanha  
Jpgjpg rfam.jpg manage 11.1 K 2011-12-08 - 06:04 GavinSaldanha Actual published structure
Jpgjpg rfam-gen.jpg manage 54.8 K 2011-12-08 - 06:04 GavinSaldanha Generated rfam using RNAfold
Jpgjpg onstruct.jpg manage 68.1 K 2011-12-08 - 05:58 GavinSaldanha Structure when On
Jpgjpg offstruct.jpg manage 75.5 K 2011-12-08 - 05:59 GavinSaldanha Structure when Off
Jpgjpg onplot.jpg manage 99.5 K 2011-12-08 - 05:57 GavinSaldanha Pairing probability plot when On
Jpgjpg offplot.jpg manage 107.4 K 2011-12-08 - 05:59 GavinSaldanha Pairing probability plot when Off
Edit | Attach | Print version | History: r27 < r26 < r25 < r24 < r23 | Backlinks | Raw View | Raw edit | More topic actions


Parents: BioE131 > GavinSaldanha
This site is powered by the TWiki collaboration platformCopyright © 2008-2013 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback
TWiki Appliance - Powered by TurnKey Linux