Fall10 > JustinWang > RnaFoldingHw

TWiki webs: Main | TWiki | Sandbox   Log In or Register

Changes | Index | Search | Go

RNA Folding Assignment

Table of Contents

Part 1

Predicted structure in OFF position.......Predicted base pairing in Off position

Predicted structure in ON position.......Predicted base pairing in ON position

commands used Command:

• RNAfold -p
• \GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
• RNAfold -C -p
• \GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
• \GGGCGACCCUGAUGAGCUUGAGUUUxxxxxxxxxxxxxxxxxxxxxxAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
• convert rna.ps rna_off.pdf
• convert dot.ps dot_off.pdf
• convert rna.ps rna_on.pdf
• convert dot.ps dot_off.pdf

Analysis In off position, the RNA sequence has all three stems present. In comparison Stem I: 8 basepairs long. Almost identical in both structure pairing

Center Bulge: Bulge in the ON confirmation is 50% bigger and causes stem 2 to be significantly shorter

Stem2

For the OFF confirmation, stem 2 is much longer. There is the presence of 1 small bulge interrupting the stem In contrast the ON configuration has only no bulge, and is terminated by the unpaired catalytic region

Stem3 : remains the same in both on and off state.

Cleavage, Almost all the bases in the catalytic region, complementary with DNA are already in base pair structure in the OFF state. Only small subsection will be able to bind. On the other hand, in the ON state, the whole complementary region is not base paired and able to bind with the DNA segment.

Part 2 Software

Pseudocode is provided in the following document Pseudocode

Part 3

Predicted Structure of Hammerhead

Actual structure taken from Wikipedia page

Failure to accurately predict could stem from many factors including that the lowest energy fold may not always be the folded form due to factors such as other molecules present, and energy barriers

I	Attachment	Action	Size	Date	Who	Comment
jpg	dot_off.jpg	manage	39.7 K	2010-10-15 - 06:23	JustinWang
jpg	dot_on.jpg	manage	36.7 K	2010-10-15 - 06:23	JustinWang
jpg	hammerhead.jpg	manage	17.6 K	2010-10-15 - 06:07	JustinWang
txt	pseudocode.txt	manage	1.2 K	2010-10-15 - 06:59	JustinWang
jpg	rna.jpg	manage	14.8 K	2010-10-15 - 06:06	JustinWang
jpg	rna_off.jpg	manage	19.6 K	2010-10-15 - 06:02	JustinWang
jpg	rna_on.jpg	manage	19.7 K	2010-10-15 - 06:30	JustinWang

Edit | Attach | Print version | History: r44 < r43 < r42 < r41 < r40 | Backlinks | Raw View | Raw edit | More topic actions

Copyright © 2008-2013 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback