Statistics for nop Fall09 Web Month: Topic views: Topic saves: File uploads: Most popular topic views: Top contributors for topic save ...

A Short Autobiography Name: Daniel Yang Email: danielxyang #64;berkeley.edu Academic Interests: My interests with Bioengineering mostly lies with ...

Biographical Information Name: Susan Chen Email: susan chen #64;berkeley.edu Interests: 1 modular design and genetic devices 1 biochemistry ...

.KamranAli 18 Dec 2009 Two of my assigned virus to review had no page or info(HumanEnteroVirus/Shawn Krisman and Poliovirus/ThorHobaek) so I didn’t rank them. I then ...

Ron Breaker works with riboswtiches. His lecture began with some basic background about RNA and riboswitches. A riboswitch resides in the 5’ untranslated region of ...

Final Project: Madhvi Venkatesh Hepatitis C Virus Team Information Team Name: The Infectious Agents Other Team Members: Jenn Brophy, Susan Chen, Sushant ...

Collective BE131 ViralHome Sushant Home Transmissible Gastroenteritis Virus JBrowse Instance To see my JBrowse Transmissible Gastroenteritis genome annotation, please ...

Measles Virus To get more information about viruses in Paramyxoviridae family, please visit http://omgbrowse.org/fall09/omg 12/family/index.html. To see my JBrowse ...

Human Coronavirus OC43 Click here to view the JBrowse genome annotation for HCoV OC43! site for HCoV OC43 Table of Contents: Introduction A member of Coronaviridae ...

How to convert GenBank to GFF3 format used for Jbrowse? I assume that you have installed a proper bioperl. The Bioperl distribution contains a script called bp genbank2gff3 ...

.SushantSundaresh 06 Dec 2009 Sushant Sundaresh (be131 10, undergraduate) BioE131 6 December 2009 Tutorial for Quantitative Multiple Alignment of Viral Genes email ...

.AshrayU 11 Dec 2009 Attached are all the files associated with submitting my final project. Ashrayjbrowse.tar: ContributionsAndLinks.txt: multialn ...

.MarkDewitt 10 Dec 2009 Mark DeWitt's JBrowse Page This page is a portal to my work on a Dengue Virus genome browser, as a member of team OMGBrowse. One of the goals ...

Collective Genome Wiki This is a collection of all of the Virus Genome Projects from the fall 2009 class of BE131. Each of the "red apples" in the abridged RNA phylogenetic ...

Respiratory Syncytial Virus Please visit OMG Browse for an interactive annotated genome with further information. Please visit OMG Browse for a one click GI number ...

Rhinovirus To see my JBrowse Human Rhinovirus 14 genome annotation, please click here. To see more information about each of the JBrowse Tracks please click here ...

home s2m Motif This motif is found in the 3' UTR of all coronaviruses. It consists of a 32 nucleotide element immediately upstream of the polyA tail (nucleotides ...

.MarkDewitt 10 Dec 2009 GFF processing from GenBank files Other members of team OMGBrowse are writing scripts that can produce genome browsers directly from genbank ...

home Transmissible Gasteroenteritis Virus Annotations Below are links to the NCBI Entrez Protein entries for each protein annotated in my JBrowse. There are also ...

How to add the "possible primers" track to JBrowse? What is a primer? A primer is a strand of nucleic acid that is used for the initiation of polymerase chain reaction ...

Human Metapneumovirus If you would like to access my JBrowse hMPV annotation, please click here! Table of Contents Human Metapneumovirus Taxonomy Genomic Data ...

.PeerapongPornwongthong 08 Dec 2009 Mumps Virus http://www.mcb.uct.ac.za/tutorial/mcb3011s/syncytia files/cpe3 data/mumps lp.gif Mumps virus (Picture source: http ...

.KamranAli 04 Dec 2009 Setting Up JBrowse on Windows via Cygwin Download Cygwin. http://www.cygwin.com/ Run the setup, and select choose to install from internet ...

This gets you simply your sequence, with the genes annotated in your JBrowse installation. Prereq: You need PuTTY to SSH in, and probably WinSCP too so you can upload ...

Name: Arthur Yu Email: ayu.yua #64;gmail.com Interests: Herbalism, computers, electronic music, the Matrix Homepage: Ayuyua.com BE131 Final Project ...

Tree .JennBrophy 06 Dec 2009

Lecture by Professor Christina Smolke from Stanford University 12 2 09 Professor Smolke's lecture was primarily focused on engineering intelligent therapeutics with ...

Mitch Skinner, developer of JBrowse, will be available in 381 Stanley on Tuesdays from 3 5pm to answer questions about JBrowse setup and configuration.

back to kyle's home ONE SHOULD ALWAYS PLAY FAILRY WHEN ONE HAS THE WINNING CARDS

.PeerapongPornwongthong 05 Nov 2009 Metabolite sensing Riboswitches: Molecular Fossils from the RNA World? Dr.Ronald Breaker November 4, 2009 Riboswitches is the ...

Back to Kyle’s main Metabolite Sensing Riboswitches(RS): Ronald Breaker Riboswitches Natural RNA elements that bind metabolites an control gene expresstion ...

Part One: Written 1. There are a number of extensive databases of protein structure that can be used to predict the three dimensional structure of a protein sequence ...

Back to Kyle’s main Table of Contents #1. Written part. Write (on a wiki page) one or two sentences explaining at least one way in which each of the following ...

.PeerapongPornwongthong 30 Oct 2009 HW6.pl.txt Set ALLOWTOPICVIEW PeerapongPornwongthong

.PeerapongPornwongthong 19 Oct 2009 HOMEWORK 5: SEQUENCE ALIGNMENT Written part 1. predicting the three dimensional structure of a protein sequence A good ...

.LizTurner 16 Oct 2009 1. Hammerhead ribozyme YES gate To obtain the minimum free energy (mfe) structure and the base pairing probability plot of the YES “off” molecule ...

Back to Kyle’s main Table of Contents #1. A short piece of biographical text. Name: Kyle Lee (Sang Hyuk Lee) Email: sanglee81@berkeley.edu ...

.DanielYang 23 Oct 2009 Table of Contents 1. Part 1: written part 1. A good alignment of the amino acid sequence allows one to find closely homologous amino acids ...

TABLE OF CONTENTS: Part One: The RNA YES 1 Gate RNA YES 1 Gate OFF 1. Predicted MFE structure: Structure is the same as predicted in the paper. 2. Base ...

RNA Logic Homework Part I: Hammerhead ribozyme YES gate Results: OFF Configuration RNASeq:GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...

.KamranAli 16 Oct 2009 Hammerhead ribozyme YES gate From the paper the sequence of the yes gate is: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...

.AndrewHu 16 Oct 2009 HW4 Hammerhead Ribozyme Yes Gate Analysis To find the minimum free energy of the folded Hammerhead ribozyme YES 1 GATE, I first extract the ...

.DanielYang 16 Oct 2009 Table of Contents 1. Hammerhead ribozyme YES gate Predicted MFE structure for OFF position Run RNAfold to predict the MFE RNA structure ...

http://biowiki.org/view/Teaching/RNALogicHomework Hammerhead ribozyme YES gate The sequence of the YES gate in question is GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...

RNA Folding Yes Gate Off Verification Procedure 1 Transpose the rna sequence below from . 1 Run "RNAfold p" from Vienna suite. 1 Input sequence. 1 ...

reversecomp2.pl.txt .SusanChen 26 Sep 2009

rev1.pl.txt .JennBrophy 24 Sep 2009

.MarkDewitt 08 Sep 2009 MARK DEWITT ASSIGNMENT 1, BIOE231 ID: 16252836 This page is a rundown of all the stuff I was forced to demonstrate as part of the "Using Wiki ...

Thor Christian Hobaek Contact information At Falkebreen (Falcon Glacier) Jun 09 Email: thorchri #64;gmail.com MSN: tc hob #64;online.no Skype: thor ...

Student group, Fall09 web Set GROUP SusanChen JohnWang ArthurYu BenChaney AlanWang SushantSundaresh LizTurner AlanWang JudyLin MarkDewitt DavidTam JennBrophy ...