WeiChunRNAfolding < Fall08

Fall08 > TWikiUsers > WeiChunHsu > WeiChunRNAfolding

TWiki webs: Main | TWiki | Sandbox Log In or Register

1. The sequence of the RNA is the following (in FASTA):

>RNAyesgate
GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

To generate the RNA Yes Gate in the OFF state, the command RNAfold -p < RNAyesgate.fa > RNAyesgate.out was executed where RNAyesgate.fa is the above file.

A file called RNAyesgate_ss.ps was created in the working directory. The command convert RNAyesgate_ss.ps RNAyesgate.pdf was executed to convert it to a PDF: RNA Yes Gate - Off

The base-pairing probability plot was generated by converting the other generated file RNAyesgate_dp.ps to PDF using convert RNAyesgate_dp.ps RNAyesgate_dp.pdf. This produced the following plot: RNA Yes Gate BP plot - Off

From the plot, it can be seen that stem 1 and 3 are present, while stem 2 is absent. In this mode, the ribozyme cannot cleave. The structure and BP plot agree well with the paper.

In order to generate the RNA Yes Gate in the ON state, a different FASTA file was used:

>RNAyesgate2
GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC
.........................xxxxxxxxxxxxxxxxxxxxxx.................................

Note that the region AGCUCGUCACUGUCCAGGUUCA is bound to an effector DNA complementary to the sequence in the ON state; thus, it is specified to be unbound (x).

Using the constraint parameter, the following commands were executed, similar to the above:

> RNAfold -C -p < RNAYesGate2.fa > RNAyesgate2.out
> convert RNAyesgate2_dp.ps RNAyesgate2_dp.pdf 
> convert RNAyesgate2_ss.ps RNAyesgate2.pdf

Two PDFs were generated: RNA Yes Gate - On RNA Yes Gate BP Plot - On

Note while the "shape" of the MFE structure does not resemble the schematic drawn in the paper due to the unspecified shape of the effector DNA binding region, the important connections including stem 2 are present. Stems 1 and 3 remain present, and thus this ribozyme can cleave. The BP plot also exactly resembles the diagram in the paper.

2. This is a rough schematic of a program to analyze a completely general YES logic gate assuming basic subroutines are defined:

Generate FASTA file of gate in OFF position (0) (no constraints)
Run RNAfold on this FASTA file
Analyze output, determine the stems that are required for cleavage (might be user specified)
Check output to see if specified stems are present -> if not, return 0, else return 1;
Generate FASTA file of gate in ON position (1) (constraints in specified OBS region denoted by 'x', all others '.')
Run RNAfold on this FASTA file
Analyze output
Check output to see if specified stems are present -> if not, return 0, else return 1;
Output logic table from above information

Possible code for stem region checking (returns 1 if the ribozyme cleaves, 0 if not):

For each stem
   For each bp from stem_start to stem_end
      If bp is base paired to correct partner Then continue
      Else return 0;
   End For
End For
return 1;

3. The viroid is shown below with the sequence that resembles a hammerhead ribozyme boxed in red. Hammerhead ribozyme sequence AF404053.1

I	Attachment	Action	Size	Date	Who	Comment
pdf	RNAYesGate.pdf	manage	4.5 K	2008-10-17 - 22:45	WeiChunHsu	RNA Yes Gate - Off
pdf	RNAYesGate_dp.pdf	manage	5.9 K	2008-10-17 - 22:53	WeiChunHsu	RNA Yes Gate BP plot - Off
pdf	RNAyesgate2.pdf	manage	4.4 K	2008-10-17 - 23:06	WeiChunHsu	RNA Yes Gate - On
pdf	RNAyesgate2_dp.pdf	manage	4.9 K	2008-10-17 - 23:07	WeiChunHsu	RNA Yes Gate BP Plot - On
png	hamr.png	manage	57.4 K	2008-10-18 - 16:55	WeiChunHsu	Hammerhead ribozyme sequence AF404053.1

Parents: TWikiUsers > WeiChunHsu