Topics in Fall08 web
Changed
Changed by
TWikiGuest 21 Oct 2008 The two structures are dissimilar. This result is expected because: 1. The input sequence is the full sequence of one particular Type I ...
Name: Alex Wu Major: Computer Science Year: Fourth Email: nanhengwu #64;berkeley.edu ^ I am an EECS BS/MS student. This is my last undergrad semester ...
Final Project Submission Zip File Archive Content: Implementation of NaiveBin in Java Final Paper (PDF) Final Presentation (PPT)
Homework Assignment 1 Q1: Computational Biology and Synthetic Biology The following two topics of Computational Biology are closely related to Synthetic Biology ...
Simple Version: Each set pixel selects a random color Final Version: Each pixel is assigned a color according to distance from the center
Mini Final Project Report (Update 2) Topic: Species Binning for Metagenomics Team Member: Alex (Nanheng) Wu Introduction: Metagenomics is an important field ...
Sequence Alignment Nussinov Algorithm Part A. Alignment Application a. An important approach to protein structure prediction is Comparative Protein Structure ...
RNA Engineering Homework Write up Question 1. 1. From the paper by Breaker and Penchovsky I first extracted the sequence of the Hammerhead Riboswitch:GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...
Sequence Alignment Algorithm Implementation is attached on this page. Below is a screenshot of running the program on the sample sequences.
Name: ami verma Email: ami.iiit #64;gmail.com Comment: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki AmiVermaSandbox ...
TWikiGuest 13 Sep 2008 2nd Base ^ ^ U C A G 1st Base U UUU Phe UUC Phe UUA Leu UUG Leu UCU Ser UCC ...
Contact Info Ana Daniela Guajardo adguajardo #64;berkeley.edu Interests 1. Bioenergy 1. Metabolic Engineering 1. Ballet Other ...
TWikiGuest 15 Sep 2008 1 Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. Go to: AnaDanielaGuajardo ...
Andrew Gearhart Profile Email: agearh #64;gmail.com Status: Graduate Student Major: Computer Science Education: BS, Computer Science and ...
Name: Ashok Patowary Email: ashokaperis #64;yahoo.co.in Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki ...
GabrielLopez 14 Nov 2008 Brian, Andrew, and Gabriel's Final Project Subject: Metagenome Binning
BadLinks Homework practices that are missing programs or have other issues. Please edit this page to describe any broken links, uninstalled software or other issues ...
# Contributing Authors ## Names PatrickHarrigan RobertKuo DavidLi JasonPai ## Contributions Patrick and David worked on programming the subroutines ...
ManoshiDatta 12 Sep 2008 Lab and Homework Assignments Here are my homework assignments from BioE 131. ManoshiDattaHomework1 ManoshiDattaHomework2 ManoshiDattaHomework3 ...
Brandon Gaytánbgaytan(at)berkeley(dot)edu I am a new graduate student in the Molecular Toxicology program. My interests lie within the field of environmental toxiology ...
BrandonGaytan 12 Sep 2008 1. Ensure homepage has a photo and biography link to homepage: BrandonGaytan 2. Two examples demonstrating how computational ...
Name: Brian Siu Email: nairb85 #64;gmail.com Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki BrianSiuSandbox ...
Name: Brian Zimmer Email: brianzimmer #64;berkeley.edu Interests: Algorithms, software engineering, synthetic biology, swing dancing ) I am a 4th year ...
Set ALLOWTOPICVIEW BrianZimmer BrianZimmer 15 Sep 2008 Computational Biology and Synthetic Biology From what I can tell, computational biology encompasses some ...
BrianZimmer 31 Oct 2008 Part 1 Answers 1. Having a good sequence alignment with a sequence which you have already predicted the structure of can give you a very ...
Name: Charles Hu Email: c.hu #64;berkeley.edu Interests: Music, Sports (Tennis, Squash, Wushu, Running), Video Games BioE: tissue engineering, drug delivery ...
Charles Hu Final Paper Team members and % contribution: Charles Hu (50%), Jason Gomez (50%) Title: Phylogenetic Correlation of Inositol Derivatives Using Perl ...
Charles Hu 17496936, chu08 #64;berkeley.edu Homework 2 programname: revcomp.pl Please see attached.
Charles Hu 17496936 chu08 #64;berkeley.edu Homework 3 program name: simulator.pl Worked with: Jason Gomez Please see attached.
Charles HU, 17496936, chu08 #64;berkeley.edu BioE131 HW 4 RNA Folding Please see attached.
Charles Hu Homework 5 (ON THIS HOMEWORK I WORKED WITH JASON GOMEZ) Part 1 1.predicting the three dimensional structure of a protein sequence; Structure ...
Charles Hu Homework 6 17496936, chu08 #64;berkeley.edu See attachment (alignment2.pl) for perl program. Please grade me by Scheme 1. Thanks!
Information Content Homework hw7.pl information content hw.doc Bayesian Inference Homework hw6a.pl hw6b.pl
Homework 8 Please see attached Homework was collaborated with Victor Olivas.
BioE 131 Mini report 11/19/2008 Team members: Charles Hu, Jason Gomez, Jefferson Chang Topic #3: A phylogenomic survey of the phospholipid synthesis pathway ...
DavidLi 18 Sep 2008 Part One Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. See DavidLi ...
DavidLi 20 Oct 2008 RNA Folding Part 1: Off Configuration: 1. Predicted MFE Structure: Use RNAfold with parameter p to calculate the MFE structure. The sequence ...
DavidLi 25 Oct 2008 Part 1 1) When attempting to predict the 3 dimensional structure of a protein from its amino acid sequence, a good sequence alignment can allow ...
DavidLi 19 Nov 2008 Final Project Project: METAGENOMICS We will examine the ability of probabilistic models to correctly identify the source of small DNA sequences ...
Name: Jiang Li Email: one.mighty.duck #64;gmail.com Bio: I normally just go by David. I'm an undergraduate transfer student in my second year at Berkeley ...
About Me David Tulga is currently a fourth year Bioengineering major at Berkeley. He is also a Regents' and Chancellor's Scholar and an undergraduate researcher ...
Final Project for David Tulga Introduction The prospect of computationally designable genetic circuits and logic gates is a goal that many fields are attempting ...
RNA Folding Homework for David Tulga Hammerhead ribozyme YES gate Verification OFF Structure: (MFE 35.90 kcal/mol) if(navigator.appName.indexOf("Microsoft ...
My Profile Derek Dashti I am resting on half dome :yes: dcdashti #64;berkeley.edu :scull: I am a 4th year undergraduate majoring in Bioengineering. I have been doing ...
DerekDashti 22 Oct 2008 Part 1 To predict the MFE structure I used the RNAfold program for the given RNA sequence in figure 2 of the Breaker paper GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...
DerekDashti 31 Oct 2008 Part 1 1) A good sequencing alignmnet is crucial for predicting a 3 dimensional structure of a protein sequence because structure prediction ...
Name: diya seb Email: diyaseb #64;gmail.com Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki DiyaSebSandbox ...
^ Name: Evan Yang ^ Email: yang the letter e @ schoolname .edu ^ Interests: Just about everything... The Biography thing I'm a third year in Bioengineering ...
EvanYang 17 Sep 2008 Homework 1 1 EvanYang 2 Computational Biology is relevant to Synthetic Biology for modeling, and organizing the massive amounts of information ...
EvanYang 23 Oct 2008 Part 1: To determine the structure of the OFF position and the base pairing probability plot of the YES gate, we add the p command, which also ...
Part 1: 1. Having a good sequence alignment can allow one to infer the structure of the protein sequence from the similar sequence. 2. Odds are, if there a mutated ...
This is my Needleman Implementation. I did the first 130 lines or so trying to maintain good coding practice, but the last 100 lines are messy. I made conscious decisions ...
Okay, this is just plain infuriating. I can't even add URLs, for goodness sake Information Content of DNA: Script: http: //inst.eecs.berkeley.edu/~cs9h av/info.pl ...
Felix Moser Email: fmoser #64;berkeley.edu Interests: synthetic biology, metabolic engineering, systems biology Brief Bio: I am a first year PhD student ...
Set ALLOWWEBVIEW FelixMoser 15 Sep 2008 1. Go back to FelixMoser 2. Computational biology tackles handling of large amount of biological data relevant ...
Multiple choice exam Wednesday 12/10/2008, 3:10pm 4pm, 458 Evans Hall. final2008.pdf final exam paper final2008 answers.pdf answers Presentations Scheduled ...
Presentations for the BioE131 FinalProject will take place during TBA . Please edit this page to sign up for a time. If there is more than one person in your group ...
Final project This page outlines the final project possibilities for BioE131/231. Brief summmary of rules The project topics are listed below. You will write up a ...
TWikiGuest 15 Nov 2008 MINIREPORT Group Members: Nina Revko Suruchi Anand Joanna Chen Ana Daniela Guajardo Project Topic: Topic #1 Species Binning ...
TWikiGuest 17 Nov 2008 MINIREPORT Group Members: Nina Revko, Suruchi Anand, and Ana Daniela Guajardo Project Topic: Topic #1 Species Binning for Metagenomics ...
Final Project The final paper is attached as a document. The codes written for the project, geneConcat.pl and gene wrapper.sh, are also attached. The zipped folder ...
Final Project Project: METAGENOMICS We will examine the ability of probabilistic models to correctly identify the source of small DNA sequences taken from a range ...
TWikiGuest 17 Dec 2008 METAGENOMICS FINAL PROJECT Suruchi Anand Manoshi Datta Ana Daniela Guajardo Nina Revko BioE 131 final report.doc: FINALREPORT project19 ...
My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki GabrielLopezSandbox just for me Related topics ChangePassword Perl Script ...
The code takes in a multiple alignment file in Stockholm format as well as a small subsection of that alignment containing three sequences. It then generates a Newick ...
Name: Gene Wolfe Email: genewolfe #64;yam.biowiki.org Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki GeneWolfeSandbox ...
nop BioE241 "final" The following is a proposal for the loosely styled BioE241 in class "final", to be held on the last day of instruction (Monday December 10th). ...
TWikiGuest 31 Oct 2008 Part 1. Written Part 1. By obtaining a good sequence alignment, crystallography 3D structures obtained from those homologous sequences ...
TWikiGuest 06 Nov 2008 HW 6 I have attached the files with the score matrix, and the hw6.pl file which has the script.
TWikiGuest 22 Oct 2008 Hammerhead ribozyme YES gate. Copied Hammerhead sequence into a file. The file HHseqoff.txt containing all the sequence in RNA form in ...
Attention Please prefix your homework page with your name.
Attention Please prefix your homework page with your name.
Final Project Siddharth Shah and Jason Lee Introduction: Metagenomics is the study of genetic material recovered from environmental samples. This is much different ...
The Final Project Siddharth Shah and Jason Lee Mini report Logistics The partners are (in no particular order): Jason Lee Siddharth Shah We are planning ...
Jason Gomez Bernal Table of Contents My Info Name: Jason Gomez Bernal ^ Email: b g@pacbell.net ^ Autobiography ...
Jason Gomez Bernal Final Report Team members and contribitions: Jason Gomez (50%), Charles Hu (50%) Title: Phylogenetic Correlation of Inositol Derivatives ...
JasonGomezBernal 22 Oct 2008
Jason Gomez Bernal Homework 1 Question 1 1. See JasonGomezBernal Question 2 1. Designer Drugs Identification of different loci/targeting centers ...
JasonGomezBernal 22 Oct 2008
Jason Gomez Bernal Homework 5 (ON THIS HOMEWORK I WORKED WITH CHARLES HU) Part 1 1.predicting the three dimensional structure of a protein sequence; ...
Jason Gomez Bernal Mini Report Team members: Charles Hu, Jason Gomez, Jefferson Chang Topic #3: A phylogenomic survey of the phospholipid synthesis pathway ...
Profile Name: Jason Lee Major: Bioengineering Year: Sophomore Email: jasonslee #64;berkeley.edu About Me: I am currently trying to find a track that ...
Broken Telephone Tree Reconstruction The reconstructed sentence is: Perfection is reached not when there is no longer any thing to add but when there is no longer ...
Homework Assignment 1 Q1: Computational Biology and Synthetic Biology The following two topics of Computational Biology are closely related to Synthetic Biology ...
JasonLee 22 Oct 2008 RNA Folding Part I: Hammerhead ribozyme YES gate Off configuration 1. Predicted MFE Structure using RNAfold Sequence: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...
JasonLee 31 Oct 2008 Homework Assignment 5 Part I 1. Having a good sequence alignment can assist predicting the three dimensional structure of a protein sequence ...
TABLE OF CONTENTS /Me.jpg Name: Jason Pai Email: jason314 #64;berkeley.edu Interests: My Links .WelcomeGuest to learn TWiki WebHome web ...
Homework 1 Question 1: Biowiki Homepage See biowiki.org homepage for picture and short autobiography. Question 2: Computational Biology and Synthetic Biology ...
Homework Lab 6 Homework This homework comes in three parts. Hammerhead ribozyme YES gate Verify the properties of the YES 1 gate in Figure 2 of the RNA logic gates ...
Homework Lab 6 Hammerhead ribozyme YES gate YES Gate OFF Position: To find the predicted MFE structure and generate the base pairing probability plot, I ran ...
Name: Jefferson Chang Email: jefferson.chang825 #64;gmail.com Interests: Computational Biology, Pharmaceuticals, DotA Year: 4th Undergrad Photo ...
JeffersonChang 17 Sep 2008 Computational biology allows us to compute and study the dynamics of a biological system before experimentally synthesizing it. Additionally ...
Tour of the Joint Genome Institute On Friday November 14th, in place of the regular nop BioE131 lecture, there will be an afternoon tour of the Joint Genome Institute ...
About Me Name: Joanna Chen Email: chen j (at) berkeley (dot) edu 3rd year Bioengineering undergraduate Interests in bioengineering: computational ...
Final Project JoannaChenMiniReport (moved to here) JoannaChenFinalReport
Final Report Introduction Metagenomics is an area of study concerned with sequencing DNA from an environmental niche as opposed to a single organism. As a result ...
Homework: Diffusion Limited Aggregation Basic Algorithm Code : hw8 simple.pl For example: hw8 simple.pl 200 simple200.png produced the following image (all ...
Homework: Information Content Code informationContent.pl 1. What does a high mutual information imply about the nucleotides at positions i and j? A high mutual information ...
Homework: Phylogeny Code hw7.pl Tree Comparison Tree generated by weighbor : Tree generated by UPGMA : The two trees generated by weighbor and UPGMA are quite ...
Homework: Sequence Alignment Part 1: Written 1. predicting the three dimensional structure of a protein sequence Proteins with similar sequence will most likely ...
Mini Report Topic #1: Species Binning for Metagenomics Metagenomics involves the sequencing of DNA of all the organisms in a sample from a selected environment. The ...
TWikiGuest 19 Sep 2008 Kobe Bryant NBA MVP 2008.jpg:
MANOSHI DATTA Affiliations: Department of Bioengineering (third year undergraduate) Hometown: West Lafayette, IN Email: mdatta #64;berkeley.edu ...
ManoshiDatta 11 Nov 2008 The work that I've done for the final project: MiniProposal FinalProjectSMNA
TWikiGuest 21 Oct 2008 Part I: Hammerhead Ribozyme YES Gate METHODS First, I copied the nucleotide sequence of the hammerhead ribozyme to a text ...
TWikiGuest 22 Oct 2008 Part 1: Written Part 1. Predicting the three dimensional structure of a protein sequence. In order to predict the three dimensional ...
TWikiGuest 25 Nov 2008 I worked on this homework assignment with Vedran Pogacnik. The assignment should be found on his page.
ManoshiDatta 27 Nov 2008 The script for the phylogenetic tree output is found below:
ManoshiDatta 11 Dec 2008 (Program completed with Vedran Pogacnik) The Perl script in the text file below outputs a tree in Newick format, given a distance matrix for ...
Name: Matt Cairns Email: mattcairns #64;yam.biowiki.org Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki ...
Name: Matthew Chin Email: mchin88 #64;berkeley.edu Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki MatthewChinSandbox ...
Metagenomics Final Project Mini Report (Submitted Nov. 12) MiniReportMetagenomicsFinalProject Group Members VedranPogacnik RinaParmeshwar TimWang ...
Metagenomics Final Project Code: Return to Main Site Part 1: Metagenomics sequence simulator This program takes N reads from M genome sequence files from a Gaussian ...
Name: Michel Nofal Email: mnofal #64;berkeley.edu About me: I'm a second year undergrad studying bioengineering. I'm interested in nop CompBio. I play a ...
#! /usr/bin/perl w ## The reason that the log ratio is useful is that ...
#! /usr/bin/perl w # recursive factorial subroutine ...
Broken Telephone Tree Reconstruction Homework First, I manually calculated the distance lengths (with help from classmates). Then, I looked for similar pairs, then ...
Broken Telephone Tree Reconstruction Homework First, I manually calculated the distance lengths (with help from classmates). Then, I looked for similar pairs, then ...
Questions 1 Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. 1 Give two examples of how ...
#! /usr/bin/perl w sub reverse complementer { if ($seq ne "") { # we don't want to run this function the first time it's called my $rev uc (reverse ...
#! /usr/bin/perl w sub stat calculator { my ($sequence) @ ; my $a 0; my $c 0; my $g 0; my $t 0; my $u 0; for ( ...
Part I OFF position Note: The file Seq2.txt contained sequence: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC The following commands ...
Part 1 1 Having a good sequence alignment would help in predicting the three dimensional structure of a protein because proteins with similar sequences are likely ...
#! /usr/bin/perl/ w ### TO BE GRADED OUT OF 105% ### sub highscore { my (@numbers) @ ; my $highest 0; foreach my $score (@numbers) { if ( ...
#! /usr/bin/perl w sub distr finder { my $row length length( ...
UPGMA perl program #! /usr/bin/perl w ...
ManoshiDatta 11 Nov 2008 FINAL PROJECT MINI PROPOSAL Option #1: Species Binning in Metagenomics CONTEXT: In metagenomics experiments, large numbers of fragments ...
Metagenomics Project (Project 1) Group members: Victor Olivas Sonny Hernandez Michel Nofal As a scientific community, we know little about the genomes ...
MatthewChin 19 Nov 2008 Group: Derek Dashti, Matthew Chin Project Topic 3 In order to explore the evolutionary history of the phospholipid synthesis pathway, we will ...
Tentative Schedule November 23: Rough version of individual parts (sequence retrieval, sequence analysis and classification/prediction) November 30: Preliminary ...
Name: Miriam Beckstein This is a dummy account, named after a character in this book: ISBN:0765309297 Wikipedia:The Family Trade http://www.sfreviews ...
ManoshiDatta 12 Sep 2008 I have no idea as to what I'll put in here. Hopefully, it'll be pretty exciting, since my other two pages were incredibly boring.
MatthewChin 05 Nov 2008 Attached is my code for the implementation of the Needleman Wunsch algorithm. Please grade my assignment according to grading scheme 1.
TWikiGuest 22 Oct 2008 Some Words on DOS and UNIX New Line Characters... If you are programming from your windows comp and using an IDE such as open perl you may ...
Its NO spam. Its test message. Sorry !!!
NinaRevko 17 Sep 2008 Homework1 Question 2. 1. Methods developed by computational biology can serve to test hypothesis and to model behavior that is predicted ...
NinaRevko 22 Oct 2008 Part1 Hammerhead ribozyme sequence from Figure 2 of the RNA logic gates paper by Breaker and Penchovsky: The sequence used: gggcgacccugaugagcuugaguuuagcucgucacuguccagguucaaucaggcgaaacggugaaagccguagguugccc ...
NinaRevko 30 Oct 2008 Homework Part 1: written part Write (on a wiki page) one or two sentences explaining at least one way in which each of the following tasks ...
Nina Revko nop I am a 4th year Bioengineering student. Computational biology subject is interesting for me. I am a person with complicated past and bright ...
NinaRevko 18 Feb 2009 My program simulator3.txt The program is able to calculate length nucleotide composition statistics from a FASTA file; optionally ...
TWikiGuest 31 Oct 2008 Part 1. Sequence Alignment 1. Good sequence alignment can allow one to use crystallography 3D structures from homologous sequences to predict ...
Homework Assignment 1 Question 1: Synthetic biology is concerned with the design and creation of new biological systems and functions. Two applications of this ...
TWikiGuest 22 Oct 2008 DIE AND WARN I had a lot of trouble trying to diagnose issues in my perl scripts because I would attempt to insert Print test\n; In areas ...
ManoshiDatta 22 Oct 2008 The attached file contains pseudocode for a Perl script that could be used in order to verify the correctness of a YES gate.
TWikiGuest 20 Oct 2008 PART I METHODS I first copied the hammerhead ribozyme sequence directly from the paper linked to on the lab page. I created a text file, hammerhead ...
Name: Ray Anaya Email: ranaya #64;berkeley.edu Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki RayAnayaSandbox ...
Final Report: Software for the creation of a Ribozyme "YES" Gate Introduction The program yesgen.pl is a perl script that generates and validates a nucleotide sequence ...
Homework 5 Part 1: Questions regarding Sequence Alignment uses 1. Since tertiary structure is dependent upon secondary structure, and if we can create a good sequence ...
Homework 4 Part 1: Verification of yes gate To start my analysis I did the following: Step 1: Read through the method given by the paper and collect all relevent ...
RayAnaya 10 Sep 2008 Homework One Below are my answers to homework one UsingWiki, completed on Tuesday, September 16th (due to some technical difficulties) Question ...
Homework Two Below is my solution to homework two, I decided to post it here just in case anyone else would like to see, please don't steal it or if you do, atleast ...
Final project mini report Topic and reason for choosing it: I've chosen to pursue the topic of ribozyme gates, in particular the YES gate as I am working by myself ...
RobertKuo 27 Nov 2008 Original sentence: Perfection is reached not when there is no longer any thing to add but when there is no longer any thing to take away Each ...
TWikiGuest 26 Nov 2008 I used numbers 10, 4, 19, 14, 20, 12, 11, 23, and 29. Original messange proposal: Perfection is reached not when there is no longer anything ...
RinaParmeshwar Email: rina(at)berkeley.edu Interests: Cancer Research, Molecular Dynamics Simulations/Modeling, Tennis and English Literature ...
BE 131 Homework 1 1. I have ensured that my biowiki.org home page (RinaParmeshwar)includes a photo and a short piece of biographical text, as outlined in the lab ...
Used cytochrome c1 DNA sequence: gi 17065553 gb AY062853.1 Arabidopsis thaliana cytochrome C AAGGAAACTTCGGCAAGCTCCAGAGAAACGAGAGTTCCGTAATCATTTTCTCTTGTTGTTCCTGATCGCG ...
BE 131 Homework 3 Perl Sequence Simulator #! /usr/bin/perl w #HW3: Sequence simulator program $calc stats $ARGV 0 ; $inputs $ARGV 2 ; if (!$calc stats) { ...
BE 131 Homework 4 I worked with VedranPogacnik to complete this homework and used the Vienna RNA software package version 1.7.2 of the RNAfold program. At the UNIX ...
BE 131 Homework 5 Sequence Alignment Part 1: Written part Write one or two sentences explaining at least one way in which each of the following tasks might be assisted ...
BE 131 Homework 6 Pairwise Alignment using Needleman Wunsch Algorithm Perl Script #I collaborated with Vedran Pogacnik. #BE 131 HW 6: Pairwise Alignment using Needleman ...
BE 131 Homework 7: Information Content of DNA Questions and Extra Credit Word processed document with answers to questions and extra credit plot was turned in on ...
BE 131 Homework 8: Bayesian Inference Although the log ratio and the posterior probability are both very similar, the log ratio provides a unique way to determine ...
BE 131 Homework 9: Phylogeny Homework Exercise Perl Code: UPGMA Algorithm Implementation #!/usr/bin/perl w #Homework 9: Phylogeny homework exercise #Input: Tidy ...
Extra Credit: Reconstruction of Broken Telephone Tree Perfection is reached not when there is no longer any thing to add but when there is no longer any thing to ...
# Personal Information Robert Kuo /Robert Pic.jpg Name: Robert Kuo Major: Bioengineering Year: Junior Email: rkuo #64;berkeley.edu Robert is in his ...
TWikiGuest 17 Sep 2008 # Assignment #1 1. Photo and Biography Please see home page. 2. Relevance of Computational Biology in Synthetic Biology Synthetic biology ...
TWikiGuest 20 Oct 2008 RNA Folding Lab Hammerhead ribozyme YES gate 1. Predicted MFE structure of YES 1 gate OFF state: RNAfold p Input string (upper or ...
TWikiGuest 31 Oct 2008 Sequence Alignments Written Part 1. When trying to predict the 3 D structure of a protein sequence, try aligning your protein sequence ...
MatthewChin 22 Oct 2008 1. A sequence alignment with a significant e value and decent percent identity implies homology between two proteins. Therefore, if we want ...
SEQUENCE ALIGNMENT LAB Part One How might each of the following tasks be assisted by having a good sequence alignment: 1. Predicting the three dimensional structure ...
Name: Shan Yi Email: shan yi #64;berkeley.edu Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki ShanYiSandbox ...
Siddharth Shah Email: skshah at berk Table of Contents Short autobiographical description I'm a junior EECS BioE double major from Virginia. I'm interested in ...
Homework 1 1 See SiddharthShah. 2 Wikipedia:Computational biology is relevant to Wikipedia:Synthetic biology in several ways. One way is that computational biology ...
#! /usr/bin/perl w ################## # Siddharth Shah # # bioe131 05 # ################## # rcFASTA.pl # reverse complement (rc) a FASTA file of DNA sequences ...
simulator.pl Generates a sequence of random bases. Can create sequences based on existing sequences or on length and composition statistics. Run with h for more information ...
Hammerhead ribozyme YES gate The OFF position of the YES gate I ran RNAfold p and entered the following sequence when prompted: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC ...
Part 1 1 The structural dogma says that sequence predicts structure. If you have a good alignment, you can predict the amino acid sequence, which is what determines ...
seqAlign.pl (should not have txt extension): seqAlign.pl.txt I'd like to be graded using scheme 1.
SijieMao 15 Sep 2008 1. Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. //TWikiDocGraphics ...
emailed to berke #64;berkeley.edu 10/15/08
Hammerhead ribozyme YES gate ON state Run RNAfold p on the sequence(in Figure 2) to obtain the MFE structure and the base pairing probability plot. Run RNAplot ...
Part I 1. Predicting the three dimensional structure of a protein sequence: A good sequence alignment would provide similar sequences which could be related ...
submitted to berke #64;berkeley.edu 11/5/05
About /wikiphoto.JPG Name: Sijie Mao ^ I am a fourth year IB and MCB(GGD emphasis)double major, interested in herpetology(especially the study of amphibians such ...
http://www.eecs.berkeley.edu/~sonnyher/img/me.jpg Name: Sonny Hernandez Email: sonny.h #64;berkeley.edu Interests: Computational biology, algorithm design ...
Sonny Hernandez Michel Nofal Final Project Submission Attached on this page you will find all the relevant material for our project. Our contributions to the project ...
SonnyHernandez 15 Sep 2008
HW 1 1. On homepage. 2. Computational biology is relevant to synthetic biology in that the sequencing technology brought on by computational biology is used in synthetic ...
Lab 7 HW Part 1: I have provided the steps to generate the same data using RNAfold commands. The same results and data can be obtained by using the RNAfold web server ...
TWikiGuest 21 Oct 2008 The structure of the hammerhead ribozyme in the ON state is shown in the attached PS file. Stem I: Intact (same as in the ON state) ...
TWikiGuest 21 Oct 2008 The structure of the hammerhead ribozyme in the ON state is shown in the attached PS file. Stem I: Intact (same as in the OFF state) ...
Student group, Fall08 web Set GROUP MatthewChin WeiChunHsu RinaParmeshwar JoannaChen JasonLee JasonPai GabrielLopez TimWang SiddharthShah CharlesHu YujieMen ...
:) Suruchi Anand Email: suruchianand #64;berkeley.edu Interests: Microfluidics, Biomedical Devices, Biomedical Imaging ...
1. See homepage: SuruchiAnand 2. Computational biology is relevant to synthetic biology in several ways. Two examples are given below: i. Sequence analysis ...
Name: Sydney Geissler Email: sydneygeissler #64;berkeley.edu Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki ...
List of Fall08 web users #ListStart A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A AlexWu 10 Sep 2008 DiyaSeb 23 Feb 2009 ...
Name: tax audit Email: audittax33 #64;yahoo.com Interests: My Links .WelcomeGuest to learn TWiki WebHome web to try out TWiki TaxAuditSandbox ...
Project Breakdown: Binning Evan, Sijie, Yujie Simulator Evan Simulation Experiment Analysis Sijie, Yujie Final Report Yujie, Sijie, Evan We are not sure ...
Project #1 Species Binning for Metagenomics Group members: BrianSiu, EvanYang, YujieMen, SijieMao Introduction: Metagenomic sequencing has generated an enormous amount ...
TWikiGuest 13 Sep 2008 Test
Introduction: Metagenomics is the study of genetic material recovered from environmental samples. This is much different than genetic analysis done on cultured samples ...
TWikiGuest 10 Sep 2008 Testing page Testing
Blah Set ALLOWTOPICEDIT IanHolmes TWikiGuest 26 Oct 2008
ManoshiDatta 12 Sep 2008 The Story of My Awesome Life I don't know why anyone would want to read this, but since you clicked the link, my incredibly boring life ...
Name: Tim Wang ^ Birthday: 29 May 1988 ^ Major: Bioengineering ^ Year: Junior ^ Email: tim.wang %$\begin{picture ...
TimWang's Broken Telephone Tree Reconstruction Part I: Gathering Data and Modification Data was gathered from all 32 of the worksheet and posted onto TreeThing ...
TimWang's Diffusion limited aggregation homework Part I: Basic Implementation A copy of this program can be downloaded here: hwk8 simple.pl #! /usr/bin/perl # This ...
TimWang's First Homework Assignment 1. Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. ...
TimWang's Fourth Homework Assignment A copy of this assignment can be downloaded here: hwk4.pl #! /usr/bin/perl w # This program is an implementation of reverse complementation ...
TimWang's Homework Assignment For Lab 5 A copy of this assignment can be downloaded here: simulator.pl #! /usr/bin/perl w ####################################### ...
TimWang's Information Content Homework Program code A copy of this assignment can be downloaded here: stockholm.pl #! /usr/bin/perl w # This program is an implementation ...
TimWang's Phylogeny homework exercise Part I: UPGMA Implementation A copy of this program can be downloaded here: upgma.pl #! /usr/bin/perl # This program is an implementation ...
TimWang's NA Folding Assignment Part I: Hammerhead ribozyme YES gate 1. Manually copied sequence from the Powerpoint slide into a file called 'YES 1' 2. Annotated ...
TimWang's Sequence Alignment Homework Part I: Written Part Write (on a wiki page) one or two sentences explaining at least one way in which each of the following ...
NB: This was compiled with from two others lists (hence the capitalization). Please note that there are probably a few typos below. 1. perfection is reached not ...
Group of users and groups authorized to add URLs to wiki pages Set GROUP StudentGroup TWikiAdminGroup HolmesLabGroup HolmesLabAlumniGroup HolmesLabFriendsGroup ...
SETALLOWTOPICVIEW VedranPogacnik, RinaParmeshwar, AllisonBerke Lab 9: Information content of DNA (homework) See my homepage for this class. Notes: I ...
Diffusion Agregation (homework) The program outputs a randomly branched structure. Homework done with ManoshiDatta. The program is tested on kepler.berkeley.edu and ...
VedranPogacnik 26 Oct 2008
This mini report outlines the plan for the final project for Bio Eng 131 Fall 2008. I have chosen final project option 1. SPECS: To make sure I properly understand ...
VedranPogacnik 03 Nov 2008 Fall08.Test on sequences of 2k letters:
Test FASTA files Return to my homepage for this class. hw2 1.fasta Both Same #3 GATCACGAATCGGGTGTTGTGCGAAGCAGTGGAAGCGCAGAACCGTCAAAAGTCCAAGATGCAGATGACT ATGC ...
Name: Victor Olivas Email: vrolivas #64;berkeley.edu Interests: Playing basketball and actively seeking to maintain excellent health. Homeworks 1VictorOlivasHomework1 ...
Homework1 19 Sep 2008 Question 1 See VicO Question 2 Bioinformatics The use of sequence alignment and gene expression gives synthetic biologists ...
Topic Changed Changed by See 100, 200, 400, 800 most recent changes See all changes
Pages most recently changed in this group of webs: "}%
Welcome to the Fall08 class wiki To get started you probably want to go to the StudentRegistration page. You might also want to look at the list of people who have ...
0b968d0d0ad33ffd8f057.txt;46;48
See also the faster WebTopicList
BioE131 BioE241 Login Register Changes Help
This is a subscription service to be automatically notified by e mail when topics change in this Fall08 web. This is a convenient service, so you do not have to ...
nop Fall08 Web Preferences The following settings are web preferences of the Fall08 web. These preferences overwrite the site level preferences in ., and can ...
TWiki's nop Fall08 web /view/Fall08 The nop Fall08 web of TWiki. TWiki is a Web Based Collaboration Platform for the Corporate World.
Statistics for nop Fall08 Web Month: Topic views: Topic saves: File uploads: Most popular topic views: Top contributors for topic save ...
See also the verbose WebIndex.
Name: Wei chun hsu Email: jimhsu at Berkeley dot edu Interests: (from facebook). In no particular order, economics, penetration testing, bioinformatics, ...
Assignment: 1 Ensure that your biowiki.org home page includes a photo and a short piece of biographical text, as outlined in the lab. See WeiChunHsu ...
1. The sequence of the RNA is the following (in FASTA): RNAyesgate GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC To generate the ...
PART I Write (on a wiki page) one or two sentences explaining at least one way in which each of the following tasks might be assisted by having a good sequence alignment ...
About me My name is Will Draper , and I am a 2nd year student with the Biophysics Graduate Group my email is my last name, all lower case, at berkeley.edu. I have ...
WillDraper 16 Dec 2008 See my proposal for this project as well. Note that the introduction here is somewhat paraphrased from my proposal... after all, the motivations ...
WillDraper 19 Nov 2008 Final Project Mini Report: Phylogenomics of Inositol Synthesis By Will Draper Introduction Inositols are a class of cyclic poly ols that are ...
WillDraper 01 Oct 2008 My second homework A perl script to parse a FASTA file, and output the reverse compliment. reverse comp.pl.txt #!/usr/bin/perl # This script ...
WillDraper 15 Oct 2008 Here is my sequence simulator #!/usr/bin/perl # wills sequence simulator primary use is to calculate sequence composition characteristics ...
WillDraper 22 Oct 2008 Hammerhead YES gate The off configuration of the YES gate no effector oligonucleotide added. To calculate the MFE of the off state, and ...
WillDraper 31 Oct 2008 Sequence Alignment and Nussinov Written Part Proper sequence alignment is critical to properly predicting a protein's 3 dimensional structure ...
WillDraper 04 Nov 2008 Here is my sequence alignment Perl script. To the best of my testing, the program works fine, so please grade this according to scheme 1. ...
#MyAnchor5 My Profile My Links ^ My Homework Assignments ^ My Calendar ^ #MyAnchor1 My Profile Name : Yujie Men ...
Number of topics:
288
See also the faster
WebTopicList

Copyright © 2008-2013 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki?
Send feedback