Home - this site is powered by TWiki(R)
Fall08 > TWikiUsers > JasonLee > JasonLeeHomework4
TWiki webs: Main | TWiki | Sandbox   Log In or Register

Changes | Index | Search | Go
-- JasonLee - 22 Oct 2008

RNA Folding

Part I:

Hammerhead ribozyme YES gate

Off configuration

1. Predicted MFE Structure using RNAfold

Sequence: GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

be131-14@kepler ~ [10:38pm]> RNAfold -p

Input string (upper or lower case); @ to quit

....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

length = 80

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

((((((((((((((((((((.(..(((.......))).)))))))).))))).....(((((....))))).))))))))

minimum free energy = -35.10 kcal/mol

(((((((((((((((((({(.,..,||,,,,...}}}.|})))))),,)))).....(((((....))))).))))))))

free energy of ensemble = -37.93 kcal/mol

((((((((((((.(((((((...................)))))))..)))).....(((((....))))).)))))))) {-29.41 d=10.92}

frequency of mfe structure in ensemble 0.0836646; ensemble diversity 15.95

see rna_off.pdf for visualization

2. Base Probability Plot

Run the RNAfold with -p option, this returns the probability plot along with the predicted MFE structure.

see dot_off.pdf for visualization

3. Status of stems I, II and III from the hammerhead structure, and accessibility of the cleavage site.

Stems I and III are present, but stem II is not paired. The cleavage site is inaccessible because stem II is not formed.

ON configuration

1. Predicted MFE structure using RNAfold

To find the on configuration, I used -C and -p to constrain the OBS and calculate the dot and rna diagrams.

Input string (upper or lower case); @ to quit

....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

.........................xxxxxxxxxxxxxxxxxxxxxx.................................

length = 80

GGGCGACCCUGAUGAGCUUGAGUUUAGCUCGUCACUGUCCAGGUUCAAUCAGGCGAAACGGUGAAAGCCGUAGGUUGCCC

((((((((.......((((((...........................))))))...(((((....))))).))))))))

minimum free energy = -28.53 kcal/mol

((((((((.......((((((...........................))))))...(((((....))))).))))))))

free energy of ensemble = -29.02 kcal/mol

((((((((.......((((((...........................))))))...(((((....))))).)))))))) {-28.53 d=0.89}

frequency of mfe structure in ensemble 0.621842; ensemble diversity 1.67

2. Base Probability Plot

The probability plot is attached as dot_on.pdf

3. Status of stems I, II and III from the hammerhead structure, and accessibility of the cleavage site.

Stems I, II, and III are all paired. The cleavage site is accessible because stem II is formed.

Part II

Software for verifying YES gate

In order to verify if the given RNA sequence is a YES gate, RNAfold can be used to find the MFE of the sequence when the OBS is obstructed and when it is not. Then, comparing these two values will verify if the sequence is a YES gate or not. If the MFE's are equal, then it is not a YES gate, if they are equal, then it is.

Given:

* RNA sequence * start and end coordinates of OBS

Error checking: If the end coord of the OBS is greater than the length of the RNA sequence, then inform the user of the problem. Also if the start coord is greater than the end coord, this should also be errored out.

First you call the RNAfold program and provide the RNA sequence (OBS unobstructed) to obtain the MFE value.

open FREERNA, "| RNAfold > RNAfree";

print FREERNA $ARGV[0];

close FREERNA;

In order to get the MFE value, you access the second line and assign it to $mfe1.

Then call the RNAfold program with the option -C. Then with the OBS constrain pattern, made from using the coordinates provided in $ARGV[1], constrain the OBS find the value of the MFE of the YES gate in the ON position.

Get the MFE value in the same way and assign it to $mfe2.

If ($mfe1 == $mfe2)

print "The RNA sequence is not a YES gate.\n

Input Output\n

0 0\n

0 0\n"

}else{

print "The RNA sequence is a valid YES gate!\n

Input Output\n

1 1\n

0 0\n"

Part III

Hammerhead ribozyme structure

Predicted Hammerhead ribozyme structure using RNAfold -p. The resulting MFE structure looks nothing like the structure given in Rfam.

the RNAfold predicted structure is attached as hammerhead_ribozyme_rna.pdf

I AttachmentSorted descending Action Size Date Who Comment
Pdfpdf rna_on.pdf manage 4.4 K 2008-10-22 - 05:02 JasonLee  
Pdfpdf rna_off.pdf manage 4.5 K 2008-10-22 - 05:01 JasonLee  
Pdfpdf hammerhead_ribozyme_rna.pdf manage 5.3 K 2008-10-22 - 05:58 JasonLee  
Pdfpdf dot_on.pdf manage 4.5 K 2008-10-22 - 05:02 JasonLee  
Pdfpdf dot_off.pdf manage 5.7 K 2008-10-22 - 05:01 JasonLee  
Edit | Attach | Print version | History: r13 < r12 < r11 < r10 < r9 | Backlinks | Raw View | Raw edit | More topic actions


Parents: TWikiUsers > JasonLee
This site is powered by the TWiki collaboration platformCopyright © 2008-2013 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback
TWiki Appliance - Powered by TurnKey Linux